Generated by All in One SEO v4.9.7.2, this is an llms.txt file, used by LLMs to index the site. # The Science Creative Quarterly in which, with respect to our name, we are as confused as you are ## Sitemaps - [XML Sitemap](https://www.scq.ubc.ca/sitemap.xml): Contains all public & indexable URLs for this website. ## Posts - [The Definitive Halloween Candy Hierarchy](https://www.scq.ubc.ca/the-2019-halloween-candy-hierarchy/) - A HISTORY It began, as all things do, with a geology joke. We ranked candy based on their ability to elicit "joy" or "despair" and then worked in that ranking in various geological strata, both real and imagined. The strata, not the ranking. This started in 2006, and grew from there. At the beginning, we - [So Much Candy Data, Seriously](https://www.scq.ubc.ca/so-much-candy-data-seriously/) - As promised, here is the candy hierarchy data for 2017. (Released Oct 25th @1:45pm PST. Will provide updated xlsx file on Oct 31st as well) . xlsx | csv | txt (d&t) | surveyQ pdf | n=2460 If you tag your work with #candyhierarchy2017 or #statscandy, I'll do my best to aggregate efforts here (and - [Advice for Potential Graduate Students - A Science Creative Quarterly Pin Up (No. 5)](https://www.scq.ubc.ca/advice-for-potential-graduate-students-a-science-creative-quarterly-pin-up-no-5/) - - FROM THE ARCHIVES - (CLICK HERE FOR PIN-UP POSTER - pdf file ~85k - We suggest photocopying at 129% - LTR to 11×17) - - - We currently have room in the lab for more graduate students. But before you apply to this lab or any other, there are a few things to keep - [A Game Theoretic Approach to the Toilet Seat Problem](https://www.scq.ubc.ca/a-game-theoretic-approach-to-the-toilet-seat-problem-2/) - - FROM THE ARCHIVES - The toilet seat problem has been the subject of much controversey. In this paper we consider a simplified model of the toilet seat problem. We shall show that for this model there is an inherent conflict of interest which can be resolved by a equity solution. Consider a bathroom with - [The 2020 Gairdner Award Winners: Picturing Science in the Classroom](https://www.scq.ubc.ca/the-2020-gairdner-award-winners-picturing-science-in-the-classroom/) - Every year, the Gairdner Awards celebrate science and research excellence in the medical health areas. Since 1957, they have given out 395 awards - 95 of these recipients would go on to also win a Nobel Prize! In collaboration with the Canadian Society of Molecular Biosciences and the Michael Smith Laboratories at UBC, these materials - [How To Fly](https://www.scq.ubc.ca/how-to-fly/) - "The knack of flying is learning how to throw yourself at the ground and miss" With these words, Douglas Adams helpfully explained concept of flying in his Hitchhiker’s Guide to the Galaxy. But the ground is really big, and, as the Tick so sagely noted, "Gravity is a harsh mistress." So herein contained is my - [A Serious Game on Gender Inequity and the Health Arena](https://www.scq.ubc.ca/wihr/) - It doesn't take long to scan today's headlines, and note the troubling incidents of #metoo, or hear word of research disparities that could potentially lead to life threatening outcomes for women. The reality is that even with the slow march of progress, there is still significant inequities in how the genders are treated in the - [Some COVID-19 Questions From a Curious and Concerned Seven Year Old](https://www.scq.ubc.ca/some-covid-19-questions-from-a-curious-and-concerned-seven-year-old/) - I got this letter the other day and it's awesome! I thought I would try my best to answer these great COVID-19 questions. Thanks Alaina! 1. Where does the virus actually come from? Right now, the best answer is likely from one of these: Yup, a bat. But how it changed from a virus that - [Charity Wanjiku: Empowering with Power](https://www.scq.ubc.ca/charity-wanjiku-empowering-with-power/) - Kenyan native Charity Wanjiku was first inspired to study architecture at the age of 10 when she saw a TV commercial for an insurance company where a businesswoman was presenting a model house to a boardroom of applauding men. Determined to pursue her passion — despite the fact that very few women enrolled in architecture - [Eugenia Duodu: Inspired, Elevated and Empowered](https://www.scq.ubc.ca/eugenia-duodu-inspired-elevated-and-empowered/) - Dr. Eugenia Duodu earned an honours Bachelor of Science degree in Chemistry and Biology from the University of Toronto in 2010, and proceeded to study medicinal chemistry as a PhD student. Fueled by her passion to improve life for others, her research focused on providing effective treatments for human diseases such as cancer. Having grown - [Nadine Caron: Barrier Breaking Surgeon](https://www.scq.ubc.ca/nadine-caron-barrier-breaking-surgeon/) - Dr. Nadine Caron was born in Kamloops, British Columbia. In 1993, she earned her Bachelor of Science degree in Kinesiology at Simon Fraser University, where she was also a star basketball player. From there, she entered medical school at the University of British Columbia, eventually graduating at the top of her class and becoming the - [I Can't Breathe](https://www.scq.ubc.ca/i-cant-breathe/) - https://content.blubrry.com/citedpodcast/SS_EP_5_I_Cant_Breath.mp3 Note that this podcast episode is part of a series on the various secondary effects of the COVID-19 pandemic. Click here to see more on their wesbite. * * * The brutal public lynching of George Floyd has sparked a rebellion against police violence and systematic racism. The mostly peaceful - [Euphemia Haynes: Fighting the Track](https://www.scq.ubc.ca/euphemia-haynes-fighting-the-track/) - Euphemia Haynes (1890-1980) was an African-American mathematician, educator and activist. She attended Smith College in Massachusetts and earn her Bachelor of Arts degree in mathematics in 1914, also later obtaining a Master of Arts degree in education from the University of Chicago in 1930. That same year, she became a professor at Miner Teachers College, - [Annie Easley: Launching Inspiration](https://www.scq.ubc.ca/annie-easley-launching-inspiration/) - Annie Easley (1933 – 2011) worked for 34 years as a mathematician, computer programmer, and rocket scientist for the National Aeronautical and Space Administration (NASA), pioneering research that made modern spaceflight possible. If there was anything harder than rocket science however, it was overcoming the discrimination that Annie faced as an African-American woman of her - [The Silencing of Alice Augusta Ball](https://www.scq.ubc.ca/the-silencing-of-alice-augusta-ball/) - A distinguished scholar and chemist, Alice Augusta Ball (1892 - 1916) accomplished more in her 24 short years than most do in a lifetime. Unfortunately, her revolutionary contributions to medicine went largely unrecognized for nearly 85 years. Alice graduated from high school at the top of her class in 1910, and by 1914 obtained two - [There is still this](https://www.scq.ubc.ca/there-is-still-this/) - There are data, figures and science in racism. But no compassion. There are rules, guidelines, policy in racism. But no justice. There are words, inactions, brutalities in racism. But no dignity. There is still this: George Floyd, Breonna Taylor, Ahmaud Arbery, Atatiana Jefferson, Botham Jean, Markeis McGlockton, Stephon Clark, Jordan Edwards, Terence Crutcher, Keith Lamont - [Reductive Genome Evolution of Obligate Symbiont Midichloria humanum: Implications of Gene Loss](https://www.scq.ubc.ca/reductive-genome-evolution-of-obligate-symbiont-midichloria-humanum-implications-of-gene-loss/) - (Click on the front page image to download the full article) Abstract: We sequenced and analyzed the genome of the Midichloria humanum, a ubiquitous intracellular symbiont, in 34 human subjects covering a range of population sizes from 1,000 to over 14,000 midichlorians per human cell. Midichlorians mediate the relationship between their human hosts and the - [Science Studies and its Mea Culpas](https://www.scq.ubc.ca/science-studies-and-its-mea-culpas/) - Note that this piece was written to accompany an excellent radio documentary series produced by the award winning Cited, and called "Technocracy and its Discontents." Click here to catch the first episode, "The Science Wars". * * * There has been something rather strange happening in a marginal corner of the humanities called science studies. - [Ghosts Are Everywhere](https://www.scq.ubc.ca/ghosts-are-everywhere/) - Large, emerald mountains materialize through the haze as our ferry approaches Tokashiki. The landscape is a contrast to the flat terrain and the bustle of Okinawa. The ride becomes rough as we get closer, but the bumps are no problem. I’m on boats regularly for work. I can handle waves. Due to lack of sleep, - [Expression Changes of Genes Associated With Structural Proteins May Be Related to Adaptive Skin Characteristics Specific to Metamorphmagi](https://www.scq.ubc.ca/expression-changes-of-genes-associated-with-structural-proteins-may-be-related-to-adaptive-skin-characteristics-specific-to-metamorphmagi/) - (Click on the front page image to download the full article) Abstract: Metamorphmagi have the ability to change their physical characteristics at will, without requiring the use of potions or spells. As such, metamorphmagi skin contains morphologically and functionally distinct properties from non-metamorphmagi skin, providing metamorphagi with heightened skin flexibility and durability. However, previous studies - [A Child's Primer on COVID-19](https://www.scq.ubc.ca/a-childs-primer-on-covid-19/) - (Deutsch | Español | 中文 | 한국어) * * * Let's start with this: This is probably a word that you keep hearing grown-ups talk about, but it’s also probably a word that is a bit of a mystery to you. There are lots of ways to explain this funny word, but let’s start by - [Una Guía Para Niños Sobre COVID-19](https://www.scq.ubc.ca/una-guia-para-ninos-sobre-covid-19/) - (Deutsch | English | 中文 | 한국어) * * * Vamos a empezar con esto: Probablemente esta es una palabra que escuchas a adultos decir mucho, pero probablemente también para ti sea un misterio. Hay muchas maneras de explicar esta palabra tan graciosa, pero comencemos diciéndote que es la razón por la cual actualmente tanta - [新冠肺炎 (COVID-19)儿童科普知识](https://www.scq.ubc.ca/covid19chinese/) - (Deutsch | English | Español | 한국어) * * * 让我们从这个词开始: 新冠肺炎, 这个词可能是近日来孩子们从大人那听到最多的一个词, 也可能 对你来说有点儿神秘感。 事实上, 有很多办法解释一个新词, 但我们就从为什么 现在有很多人要呆在家里?为什么学校关门?为什么不能和好朋友一起玩儿? 还有为什么爱你的人要一直告诉你好好洗手?还要特别关心祖父母们? COVID-19 是一种能使人得病的东西。这种东西叫做病毒。 事实上病毒有很多种类型。 就像是有很多种类型的鸟,比如: 鸭子,小鸡 还有猫头鹰。 病毒也有很多种, 只不过在学校可能还没有学到它。 病毒实际上无所不在。 大多数病毒对人类并无伤害。 但不幸的是, 有几种我们常听说的可使人致病。 例如: 引起普通感冒的鼻病毒 Rhinovirus, 引起流行性感冒的流感病毒 Influenza Virus. 这种COVID-19 新冠肺炎, 是由 冠状病毒引起。 让我们看看COVID-19 名字的由来吧 很有趣吧? 现在我们知道了COVID-19 来由。 它是一种病, 可以让人得的病,是一种由病毒引起的病。 这是一种特别的冠状病毒,最初是科学家在2019 年发现的。 病毒非常非常小。小到我们用肉眼无法看到。一般的显微镜也不行。而且它们也很奇怪。 甚至科学家也无法断定它们是死的还是活的, 或者介于两者之间。 它们不会长大, 也不会呼吸,也不在乎生存环境, 自己不会行走,不吃东西。 - [COVID-19 für Kinder Erklärt](https://www.scq.ubc.ca/covid-19-fur-kinder-erklart/) - (English | Español | 中文 | 한국어) * * * Beginnen wir mal hiermit: Dieses Wort hast du wahrscheinlich schon viel gehört. Die Erwachsenen reden im Moment ständig davon. Aber es ist für dich sicher auch ein etwas rätselhaftes Wort. Dieses seltsame Wort kann man auf viele verschiedene Arten erklären. Das, was dahintersteckt, ist der - [어린이들을 위한 COVID-19의 이야기](https://www.scq.ubc.ca/covid19korean/) - (Deutsch | English | Español | 中文) * * * 이 단어를 보면 무엇을 떠올리나요? 요즘 여러분들은 사람들에게 이 단어를 많이 듣고 있을 겁니다. 이 재미있는 단어를 여러 가지 방법으로 설명할 수 있어요. 일단 현재 많은 사람들이 집에 머무르는 이유, 학교가 잠시 문을 닫는 이유, 사람들이 친구들과 놀지 않는 것이 더 좋다고 말하는 이유로부터 시작하겠습니다 . 이 - [Zucchinis are Gross (or other normal mother-daughter conversations)](https://www.scq.ubc.ca/zucchinis-are-gross-or-other-normal-mother-daughter-conversations/) - (This comics piece has been modified for easy viewing on mobile platforms. For the original one page version of this comic, please click on this link here. Thanks, SCQ editors) - [Introducing the Phylo Trading Card Game DIY Home School Activity.](https://www.scq.ubc.ca/introducing-the-phylo-trading-card-game-diy-home-school-activity/) - With the pandemic being part of our daily lives, school has had to make some adjustments. Because of this, the SCQ thought it would be cool to point out one of our sister projects: one that we're certain would be a great way to learn some science, think about the environment, and all the while, - [The Unicorn Microbiome: A proposed microbial mechanism for the rainbow pigments in unicorn poop.](https://www.scq.ubc.ca/the-unicorn-microbiome-a-proposed-microbial-mechanism-for-the-rainbow-pigments-in-unicorn-poop/) - (Click on the front page image to download the full article) Summary: Unicorns (Equus unicornis) are a rare terrestrial mammal, which have been noted to produce a variegated pigmented feces that is often referred to as “rainbow poop.” Despite considerable commercial interest in unicorn rainbow poop, the mechanism leading to this rainbow-pigmentation remains unknown. Microbial - [My Apologies for Predicting Our Current Dystopia](https://www.scq.ubc.ca/my-apologies-for-predicting-our-current-dystopia/) - Dear Thesis Committee Members, Thank you for your feedback on my latest draft. I was a little confused by your criticism that my dystopian sci-fi screenplay read as too accurate and the subsequent questions insinuating my possible membership in a clandestine deep state conspiracy. When I started writing a satire of late-stage capitalism involving a - [The Journey of Kale: Why What We Eat Matters](https://www.scq.ubc.ca/the-journey-of-kale-why-what-we-eat-matters/) - ORIGIN STORY: MY FRIDGE This afternoon I opened my fridge, pulled out the crisper drawer, and grabbed a bundle of kale to add to my lunch. With this seemingly routine activity, I noticed for the first time that my kale bore a label for “Joe Heger Farms”. Who is Joe Heger? A quick google search - [Genetic Association between WZRD-1 Variants and the Variation in Magical Abilities in Canadians](https://www.scq.ubc.ca/genetic-association-between-wzrd-1-variants-and-the-variation-in-magical-abilities-in-canadians/) - (Click on the front page image to download the full article) Abstract: Current literature lacks a consensus on the mechanism of biological inheritance of magical abilities. Past findings have suggested that the presence of restriction enzyme digestion sites in WZRD-1 are associated with variations in human magical abilities. In this study, Next Generation Sequencing (NGS) - [Sacrifice](https://www.scq.ubc.ca/sacrifice/) - Trace thumb along gut. Ignore the ammonia odour of sacrifices past. Aim for the triangular target. Squeak. A bead of urine emerges. Hold faith, the church of reason, the sake of humanity. Prepare for fixation: Splay spine against styrofoam board paper towel lined. For the sake of humane tap paws for reflex. Pin apart palms. - [PLANTS: AMAZING PHYTO-PHARMACIES](https://www.scq.ubc.ca/plants-amazing-phyto-pharmacies/) - (Art by Armin Mortazavi) Some of the best chemical engineers in the world don’t have a university degree. The most prolific institutions (if they can be called that) don’t have professors or laboratories. The chemicals themselves boast more complicated architectures than humans could imagine. The working conditions are dirty and crowded, but somehow the immobile - [INTEGRINS AND THE SOCIAL NETWORK OF CELLS](https://www.scq.ubc.ca/integrins-and-the-social-network-of-cells/) - (Art by Armin Mortazavi) When imagining a cell, it’s often easy to think of it as a lone entity, a single squishy bubble of fluid. However, cells are actually incredibly complex, and they can organize in ways to form many types of structures and ultimately whole living organisms like a tree, a bird, or even - [DNA REPLICATION: NOT YOUR OFFICE PHOTOCOPIER](https://www.scq.ubc.ca/dna-replication-not-your-office-photocopier/) - (Art by Armin Mortazavi) If the letters in the human genome, your DNA code, were a book, it would take a person typing 60 words per minute, 8 hours a day, around 50 years to copy the 3 billion base pairs. This incredible task of replicating all the genetic material in a cell must be - [KINESIN: THE LITTLE ENGINE THAT COULD](https://www.scq.ubc.ca/kinesin-the-little-engine-that-could/) - (Art by Armin Mortazavi) When we are learning about cells and how they function, we are often confronted with large, circular blob-like things that contain several different internal structures for us to memorize. It may be tempting to dismissively think of cells as being nothing more than these simple, two dimensional objects (after all, they - [SPOKEN IN STARDUST: MEMORIES ADRIFT ACROSS AN OCEAN OF TIME](https://www.scq.ubc.ca/spoken-in-stardust-memories-adrift-across-an-ocean-of-time/) - Cast of Characters: Emma: an inquisitive teen-aged daughter Father: a neuroscientist with a love of theatre and the arts, Emma’s dad Mother: a neurologist who loves to garden and grow flowers, Emma’s mom David: a kind, sensitive nine year old boy who adores his sister, Emma Mr. Jiang: protagonist of the play Remember Me, Alzheimer’s - [A UNIVERSITY JOB POSTING (OR BECOMING A PROFESSOR IS HARD THESE DAYS)](https://www.scq.ubc.ca/a-university-job-posting-or-becoming-a-professor-is-hard-these-days/) - This is a call for outstanding candidates to apply for a tenure track assistant professor position within the context of the Department of [subject name] at the [institution name]. The successful applicant is expected to work in areas of interest to current faculty members, to interact with related groups within our network and to have - [A BIOCHEMIST'S BOOKLIST](https://www.scq.ubc.ca/a-biochemists-booklist/) - Are you a fan of literature? Whether you have a background in science and are looking for your next great read for those wait times between gel runs, or are an experienced literature enthusiast looking to better understand aspects of molecular biology and biochemistry, this list is for uracil. C.A.Q. – Commonly Asked Questions (or - [TRUMPIAN SCIENCE: A SHORT GUIDE](https://www.scq.ubc.ca/trumpian-science-a-short-guide/) - Science should be done with all the “best” words. Data is shown via tweets. Folks with “intelligence” not to be trusted. China is mathematically removed in climate change projections. Hypotheses all end with a “CHA-CHING!” Scientific credentials include showing your birth certificate. “Pussy” is a medically recognized term. Citations include lawsuits. Expert peer review still - [AN INTERVENTION LETTER TO BRAD, A DEADPOOL FAN](https://www.scq.ubc.ca/an-intervention-letter-to-brad-a-deadpool-fan/) - Dear Brad, I love you very much and it breaks my heart to write this letter. For a long time, I believed that your fascination with Deadpool was just a phase. But it has driven us apart. It is clear that you believe you can regenerate limbs like Deadpool, but you are harming your physical - [VOYAGE OF THE BEAGLE (DARWIN!) PHYLO DECK IS NOW AVAILABLE.](https://www.scq.ubc.ca/voyage-of-the-beagle-darwin-phylo-deck-is-now-available/) - The Voyage of the Beagle Phylo Deck is now available for free download, and/or for revenue neutral purchase (both as a boxed set, and a cheaper cards only option). Many thanks to Karen James for her research work on which organisms to showcase (and where they were found), as well as the awesome artistry exhibited - [THE HOLIDAYS ARE NOT REALLY ABOUT SCIENCE](https://www.scq.ubc.ca/the-holidays-are-not-really-about-science-3/) - CHRISTMAS 1970. by Spike Milligan A little girl called Sile Javotte Said 'Look at the lovely presents I've got' While a little girl in Biafra said 'Oh what a lovely slice of bread'. - - - - -The SCQ wishes you a Happy Holidays, and invites you to please enjoy (or re-enjoy) some of our holiday - [A BRIEF GUIDE TO COMBATTING MASS SURVEILLANCE](https://www.scq.ubc.ca/a-brief-guide-to-combatting-mass-surveillance/) - Mass surveillance has been the norm for decades, and is growing rather than shrinking even as public knowledge of it increases. Spy agencies surveil entire countries the world over, targeting political dissidents and minorities more than terrorists and subverting the free expression essential to democratic processes. These practices harm liberty and security alike according to - [MUTATIONS IN THE SEED REGION OF WIZARD mIR-96 ARE RESPONSIBLE FOR HEREDITARY PARSELTONGUE HYPERACUSIS](https://www.scq.ubc.ca/mutations-in-the-seed-region-of-wizard-mir-96-are-responsible-for-hereditary-parseltongue-hyperacusis/) - Annals of Praetachoral Mechanics (2016). Vol 2. Advanced online publication. download pdf ABSTRACT Parseltongue is a rare hereditary trait that allows wizards to communicate in the language of serpents. Wizards who are parseltongue not only have the ability to speak to serpents (parselmouth), but also possess the ability to hear ultrasonic frequencies produced by the - [OH LOOK, IT'S THE CANNABIS CARD, AND THE THC CARD... (PHYLO PHYTOCHEMISTRY EXPANSION DECK)](https://www.scq.ubc.ca/oh-look-its-the-cannabis-card-and-the-thc-card-phylo-phytochemistry-expansion-deck/) - Just a quick word to let you know that our sister site (The Phylo TCG Game) has finally launched the purchasable version of their Phytochemistry Expansion Deck (also available as a free download). Now you can mix and match potent drugs with the botanical species they were derived from. Anyway, here are the details on - [AN INTRODUCTION TO CREATINE](https://www.scq.ubc.ca/an-introduction-to-creatine/) - Many profits in the supplement industry are generated by making exaggerated claims about their products. Despite the popularity of such supplements, few are very well researched and the industry itself isn’t well regulated. In fact, one popular pre-workout stimulant, Jack3d, was recently banned in the United States because it contained an illegal dietary supplement, dimethylamylamine - [ADVANCED QUANTUM THERMO-DYNAMICS IS NOT A GREAT TITLE FOR CLICKBAIT, BUT IT IS A GREAT TITLE TO LOOK LIKE A SMARTASS IN PUBLIC](https://www.scq.ubc.ca/advanced-quantum-thermo-dynamics-is-not-a-great-title-for-clickbait-but-it-is-a-great-title-to-look-like-a-smartass-in-public/) - Just a quick note to say that (just in time for Christmas) the book, Advanced Quantum Thermodynamics, is now available in a pocketbook version, which also happens to come with a new smart looking vintage cover. In case, you've forgotten, this is not about literature, it's not even about thermodynamics (read the smaller font subtitle), - [WHY SOME PEOPLE MAKE THE WRONG DECISION AND OTHERS DON'T: AN ASSESSMENT OF ARITHMETIC AND GEOMETRIC PROJECTIONS OF THE FRIDAY-SUNDAY DIVIDE BEYOND THE MEHSPAIR CHASM WITH P-VALUES, χ2, AND LICORICE](https://www.scq.ubc.ca/why-some-people-make-the-wrong-decision-and-others-dont-an-assessment-of-arithmetic-and-geometric-projections-of-the-friday-sunday-divide-beyond-the-mehspair-chasm-with-p-values-χ2-and-licor/) - ABSTRACT So it’s come to this. Another year has passed and another Candy Hierarchy survey has been completed. Check that. “Candy Hierarchy” is what yahoos call it, but to us, it’s a deep dive into the Friday/Sunday question that has blessed our species since caveman times. Caveman times. We’ve taken a look at the data, - [REFUGEE SCREENING: A BRIEF INTRODUCTION (AND A REQUEST FOR EQUIPMENT)](https://www.scq.ubc.ca/refugee-screening-a-brief-introduction-and-a-request-for-equipment/) - In an increasingly chaotic world, people fleeing life-threatening chaos—refugees—are a growing group. Today over 65 million displaced people—representing the biggest wave of mass displacement since World War II—seek safer, better lives in new countries, cultures, languages, fields, and communities. Many are climate refugees—people displaced by the effects of climate change. This group will probably grow - [DREAM LAB](https://www.scq.ubc.ca/dream-lab/) - To sleep perchance to Sit in a dark room Ventilation buzzing A slow wave behind Double doors trap the Night walking wake Subject to deep remembering Five candles stage One’s existence up Late without flux Blind little boxes React timelessly In anticipation Eyeful corner Monitored awake Somnolent book Oh, lab of my dreams Collect all - [2016 CANDY HIERARCHY: SUPPLEMENTAL RAW DATA AND NEW ANALYSES](https://www.scq.ubc.ca/2016-candy-hierarchy-supplemental-raw-data-and-new-analyses/) - PREAMBLE: This is for you data nerds who might want to dig into the data a little deeper (we didn't have a lot of time to play around with it). We've provided access to the full excel spreadsheet (which also includes data that was cut off from our analysis due to us having to get - [TELL US ABOUT YOUR HALLOWEEN CANDY PREFERENCES, AND OTHER THINGS BESIDES](https://www.scq.ubc.ca/tell-us-about-your-halloween-candy-preferences-and-other-things-besides/) - With so many costumes adorning this election season, you might think the Halloween get-ups are overkill. Think again, because David Ng and B.R. Cohen are here to present the official universal survey about your candy favorites for the 2016 hierarchical delineation of candy virtue. There’s the stuff about science, and ranking, and surveys, and strata, - [THE LAB CULTURE: A TRUE SCIENTIFIC HORROR STORY](https://www.scq.ubc.ca/the-lab-culture-a-true-scientific-horror-story/) - My first co-op placement was in a research lab, four and a half thousand kilometres away from my home university. For the first week or so, it was like taking a really intense lab for a university class, except the prof was just judging me instead of grading me. He would ask me questions to - [NucSh REGULATES NECESSARY NUCLEIC SHRINKAGE FOR GENOME SWAP IN POLYJUICE POTION](https://www.scq.ubc.ca/nucsh-regulates-necessary-nucleic-shrinkage-for-genome-swap-in-polyjuice-potion/) - Annals of Praetachoral Mechanics (2016). Vol 2. Advanced online publication. download pdf ABSTRACT This study provides further investigations into the wizarding potion known commonly as the Polyjuice potion; and specifically to assess the contribution of the known fluxweed protein, NucSh. NucSh has been previously shown, via co-immunoprecipitation experiments, to be part of the PhageCrux Complex, - [10 QUESTIONS I HAVE FOR SCIENCE](https://www.scq.ubc.ca/10-questions-i-have-for-science/) - 1. In the not-too-distant future, a tree will fall in the forest. Is there any chance it will have been knocked over by some kind of rampaging robot? 2. When the world's armies are finally equipped with laser rifles, how difficult will it be for a civilian to get his hands on one, and do - [THE CELL-ECTION: ON THE CAMPAIGN TRAIL](https://www.scq.ubc.ca/the-cell-ection-on-the-campaign-trail/) - It's election time! Whether discussed in casual conversations or featured in heated arguments, the campaign trail is one that many have followed. The highly anticipated day when voters take to the polls will ultimately lead to huge changes on a number of fronts. The major parties have advertised their platforms on many occasions and statistics - [REALISTIC INDIANA JONES MOVIES](https://www.scq.ubc.ca/realistic-indiana-jones-movies/) - Indiana Jones and tomb that had already been looted by robbers in the 19th century Indiana Jones and pottery fragment #1478 Indiana Jones and the site discovered under somebody’s house so there was no way to actually dig it Indiana Jones and the famous treasure that actually turned out to be an ancient chamber pot - [HIPPOPOTAMUS](https://www.scq.ubc.ca/hippopotamus-2/) - Many years ago, a hippopotamus decided to learn typing. As you may imagine, the task was difficult and discouraging. The hippopotamus however was unusually persistent. First she learned the parts of the typewriter, then she studied all available typing manuals, (even one for an antique which had neither name nor function in any western language; - [CANCER IMMUNOTHERAPY: A BRIEF INTRODUCTION](https://www.scq.ubc.ca/cancer-immunotherapy-a-brief-introduction/) - Over the past few decades, cancer therapy has advanced in leaps and bounds. Despite this improvement (and also spurred on by it), scientists and researchers are constantly looking for newer and better ways to treat cancer patients. Traditionally, cancer patients are treated with chemotherapy, radiation therapy or surgery. Chemotherapy is a treatment that uses drugs - [DONALD TRUMP WRITES A SCIENCE GRANT](https://www.scq.ubc.ca/donald-trump-writes-a-science-grant/) - Principal Investigator: Trump, Donald. Title: The Best Biology Aims: Do a lot of things and see what happens. Background and Significance: I did very well in school. I learned a lot of things. Innovation: We will do a lot of things that have never been done before, and then we will do them again. Research - [LET ME TELL YOU ABOUT JOHN MICHAEL GRIFFIN, JR.](https://www.scq.ubc.ca/let-me-tell-you-about-john-michael-griffin-jr-3/) - - FROM THE ARCHIVES -Griff, as he was known in high school, was a friend of mine. In fact, late in the first half of our lives, he stood up for me physically and philosophically, for being a science geek. Truth is, John's endorsement was the first time I was ever deemed cool for wanting - [IDENTIFICATION AND LOCALIZATION OF THE SANEW GENE IN MAGICAL WOLFSBANE (ACONITUM ALUPUS)](https://www.scq.ubc.ca/identification-and-localization-of-the-sanew-gene-in-magical-wolfsbane-aconitum-alupus/) - Annals of Praetachoral Mechanics (2016). Vol 2. Advanced online publication. download pdf ABSTRACT For more than 100 years, those suffering from werewolfism have relied on the Wolfsbane Potion to maintain cognitive abilities during transformation. Recent developments in biotechnology and biochemistry have allowed for in-depth study of the chemistry and genetics of magical plants such as - [SILLY EXAMPLES OF THE INAPPROPRIATE USE OF SCIENCE JARGON](https://www.scq.ubc.ca/silly-examples-of-the-inappropriate-use-of-science-jargon/) - Monday Night FootTESTIS Hootie and the FUGU RUBRIPES Winnie the FECES MASTICATEbacca the Wookie Tchaikovsky’s BERTHOLLETIA EXCELSA-cracker Suite I can’t believe it’s not TWO BUTTOCKS AND AN ANUSer Joani PRODUCES OXYTOCIN FOR Chachi Bye bye Miss American CIRCUMFERENCE DIVIDED BY THE DIAMETER Chairman FELINE VOCALIZATION’s Little Red Book Hey FORNICATE FORNICATE, the Cat and the - [WHAT IS IN THE JAR?](https://www.scq.ubc.ca/what-is-in-the-jar-3/) - This is a collaborative poem written by Grade 5 and 6 students on the contents of a “jar.” This jar was a prop that was used to discuss poetry and science, as well as segue into a DIY cloud chamber activity for detection of sub atomic particles. - - - I think hockey pucks are - [THE JAR](https://www.scq.ubc.ca/the-jar/) - This is a collaborative poem written by Grade 5 and 6 students on the contents of a “jar.” This jar was a prop that was used to discuss poetry and science, as well as segue into a DIY cloud chamber activity for detection of sub atomic particles. - - - I am SAD inside but - [SURVEILLANCE SONNET #73](https://www.scq.ubc.ca/surveillance-sonnet-73/) - Light comes in many colors: ROYGBIV, above, below, between. Cables bring light across borders, so we’re closer than we’ve ever been. Optical fiber cables carry light with digital information. That info contains the phone, Net, and TV of a nation. That time of history thou mayst indeed behold In which kings and soldiers take back - [MENDELEEV INVENTS THE PERIODIC TABLET](https://www.scq.ubc.ca/mendeleev-invents-the-periodic-tablet/) - [FLORIGEN: THE HIDDEN HORMONE](https://www.scq.ubc.ca/florigen-the-hidden-hormone/) - Introduction It’s a mysterious substance with a mysterious past: intrigue and imprisonment followed the first suggestion of its existence, and a lifetime of labour could not discover its identity. Mikhail Khristoforovich Chailakhyan, a biologist in the USSR during Stalin’s reign, argued in 1936 that there must be a hormone – called florigen – that causes - [TRUE FACTS ABOUT THE GIANT SEQUOIA: OR WHAT KIND OF NAME IS SEQUOIADENDRON GIGANTEUM](https://www.scq.ubc.ca/true-facts-about-the-giant-sequoia-or-what-kind-of-name-is-sequoiadendron-giganteum/) - Imagine a large tree. Now imagine a much larger tree. That is how the giant sequoia do. No, let's try this again. Imagine a large tree. Now imagine this tree as a branch, not a tree, attached to another much larger tree. Now imagine that much larger tree. That is how the giant sequoia do. - [BIODRIVE LEAK](https://www.scq.ubc.ca/biodrive-leak/) - A biodrive hides under a tattoo on my thigh, with enough memory to store data from neuroscience experiments I transport, airgapped. Covert pharmaceutical labs develop nootropics for troops and VIPs, cognitive enhancements and novel treatments for neurodiversities. Post-doc double agents steal data for competing labs, and rendezvous with me to transfer it to my wetware. - [EXPRESSION OF MaGc77 IS A SPECIFIC AND SENSITIVE MARKER FOR THE PATRONUS (Pt) CHROMOSOME (MGR-ABL1) TRANSLOCATION IN INHERITED MAGICAL ABILITIES](https://www.scq.ubc.ca/expression-of-magc77-is-a-specific-and-sensitive-marker-for-the-patronus-pt-chromosome-mgr-abl1-translocation-in-inherited-magical-abilities/) - Annals of Praetachoral Mechanics (2016). Vol 2. Advanced online publication. download pdf ABSTRACT Magical abilities have been estimated to occur in about 17% of the human population. However, the cause of discrepancy between wizards/witches and muggles (non-magical humans) remains largely unknown. More surprisingly, the presence of squibs (individuals with no magical abilities despite a magical - [2015 CANDY HIERARCHY: SUPPLEMENTAL RAW DATA AND NEW ANALYSES](https://www.scq.ubc.ca/2015-candy-hierarchy-supplemental-raw-data-and-new-analyses/) - PREAMBLE: This is for you data nerds who might want to dig into the data a little deeper (we didn't have a lot of time to play around with it). We've provided access to the full excel spreadsheet (which also includes data that was cut off from our analysis due to us having to get - [STRATIGRAPHICAL ANALYSIS OF FRIDAY-SUNDAY IDENTIFICATION IN RELATION TO SUGAR CONSUMPTION PREFERENCES AND RELATED DEMOGRAPHIC VARIABLES](https://www.scq.ubc.ca/stratigraphical-analysis-of-friday-sunday-identification-in-relation-to-sugar-consumption-preferences-and-related-demographic-variables/) - Advanced online publication. Download pdf. *Data Analysis report for the 2015 Candy Hierarchy (raw data | source reference) ABSTRACT The 2015 Candy Hierarchy defines the quality ranking of all known candies (minus those that were not ranked). It’s really easy to analyze too. We did it. Here are the results. They reveal a natural law - [THE INSIDES OF A JAR](https://www.scq.ubc.ca/the-insides-of-a-jar/) - This is a collaborative poem written by Grade 4 and 5 students on the contents of a “jar.” This jar was a prop that was used to discuss poetry and science, as well as segue into a DIY cloud chamber activity for detection of sub atomic particles. - - - A world where anything is - [THE MYSTERY OF THE JAR](https://www.scq.ubc.ca/the-mystery-of-the-jar/) - This is a collaborative poem written by Grade 4 and 5 students on the contents of a “jar.” This jar was a prop that was used to discuss poetry and science, as well as segue into a DIY cloud chamber activity for detection of sub atomic particles. - - - What is in the jar? - [DISPATCH FROM THE E.R.](https://www.scq.ubc.ca/dispatch-from-the-e-r/) - I sat down on the folding chair in front of the emergency room admitting nurse and explained what had happened: “I’ve had an accident in my laboratory.” I was expecting a dramatic reaction. Instead I got barely a raised eyebrow. It must take a lot to surprise an emergency room nurse but still, hadn’t she - [CELL BIOLOGY VIA SEVENTEEN-SYLLABLES: LESSONS THROUGH HAIKUS](https://www.scq.ubc.ca/cell-biology-via-seventeen-syllables-lessons-through-haikus/) - Introduction Since I have a fierce love for cell biology (I did complete my BSc. in Molecular, Cell and Developmental Biology, after all), what follows is a brief overview of cell biology that someone in grade 12 could understand. We start with animal and plant cells, and the various organelles in each before we marvel - [MY NEUROTIC PATIENCE](https://www.scq.ubc.ca/my-neurotic-patience/) - "I started my professional activity as a neurologist trying to bring relief to my neurotic patients…"—Sigmund Freud in his only known audio recording - - - My neurotic patience bids me dance by candlelight waiting for answers that come in time. Its quiet causes fright in the noisier set—day-planning superego, demanding id, the rest. To - [WHAT IS IN THE JAR?](https://www.scq.ubc.ca/what-is-in-the-jar-2/) - This is a collaborative poem written by Grade 4 and 5 students on the contents of a “jar.” This jar was a prop that was used to discuss poetry and science, as well as segue into a DIY cloud chamber activity for detection of sub atomic particles. - - - There is gravity in this - [WZRD1 GENE, A POSSIBLE MARKER FOR SQUIBIDITY DISORDER IN HOMO SAPIENS](https://www.scq.ubc.ca/wzrd1-gene-a-possible-marker-for-squibidity-disorder-in-homo-sapiens/) - Annals of Praetachoral Mechanics (2016). Vol 2. Advanced online publication. download pdf ABSTRACT From the limited number of studies previously done on Squibidity, there is great potential for advancements that would further our understanding of this disorder, and which would benefit both magical and non-magical people. Squibidity, is one of the most mysterious conditions to - [HOW TO FART IN FRONT OF YOUR BOYFRIEND](https://www.scq.ubc.ca/how-to-fart-in-front-of-your-boyfriend/) - i. hide your farts all over the house. under couch cushions, inside desk drawers. between bank statements, and behind the tv. he will find one eventually. ii. let them get acquainted without your presence. if you casually leave them in a room together it will give them an opportunity to familiarize themselves without relying on - [THE SECRET SCIENCE OF VIDEO GAMES](https://www.scq.ubc.ca/the-secret-science-of-video-games/) - Video game developers are using crude experimental psychology and behavioural economics to make simple games that get you hooked. One professor used satire to fight back, but not everyone got the joke. This week’s guests: Ian Bogost, Jason Tanz, Adam Scriven, Nicholas Lovell, Ramin Shokrizade, Jamie Madigan, James Ivory, and Richard Smith. To check out this episode's - [A YOUNG VENN HEADS TO THE DIAGRAM CONVENTION](https://www.scq.ubc.ca/a-young-venn-heads-to-the-diagram-convention/) - Venn’s been working on this for years. With the convention drawing close, his pace accelerates. Late nights. Early mornings. Lost sleep. Mid-day coffee. In the earliest fraction of morning light, his wife leans against the kitchen counter, sipping the day’s first mug of coffee. “Are you ready, darling?” The lip of the cup reaches her - [ON SUGAR, PARALLEL UNIVERSES, AND UTILITARIAN SELFISHNESS](https://www.scq.ubc.ca/on-sugar-parallel-universes-and-utilitarian-selfishness/) - As selfish as a dog in a manger: this self-gratifying dog is found lying on the hay originally intended for the hard-working horses, and you, the witness, can only gaze in horror. In Horror, but not shock; not shock as you could have expected no less from a dog as selfish as this. You do - [8 ONE-SENTENCE STORIES ABOUT LOVING ROBOTS](https://www.scq.ubc.ca/8-one-sentence-stories-about-loving-robots/) - 1. The celebrity chef loves her drone, posting its photos of her organic farm on a blog, and now hipsters picnic on farms illegally. 2. I love the robot even more desperately knowing it can't love me back, will never lie, and is more attentive than my ex. 3. Taking a selfie with a star - [EPISODE 3: PAPERS](https://www.scq.ubc.ca/episode-3-papers/) - EPISODE 1 | 2 | 3 | 4 Papers, deadlines, awkward conversations with your professor, and PhD job prospects - we tackle all these issues in our latest episode. But of course, we do it with some humour. Think managing your PhD is hard? Wait till you get into the real world. Be sure to - [EPISODE 4: DEGREES](https://www.scq.ubc.ca/episode-4-degrees/) - EPISODE 1 | 2 | 3 | 4 Second guessing your PhD? You are not alone. In the fourth episode of the series, the characters are asked that question we’ve all been asked: “Why not med school?” This makes them wonder about life after their PhD. Meanwhile, Dave has office hours, and an upsetting decision - [(M + M)i: A PROOFREADER'S LOVE STORY](https://www.scq.ubc.ca/m-mi-a-proofreaders-love-story/) - One did not speak of dinner with Andrey Andreyevitch Markov, only the probability of dinner. And that probability might change, of course, depending on whether the great man had taken lunch, or gone without since his usual breakfast of black tea, unripe cantaloupe, and potato knish, or snacked perhaps on a thick slice of that - [ADVANCED QUANTUM THERMODYNAMICS (is a subject I know very little about)](https://www.scq.ubc.ca/advanced-quantum-thermodynamics-is-a-subject-i-know-very-little-about/) - This is the title of a new book that collects the various published science humour and creative non-fiction writings of David Ng. See how clever one looks, even whilst "pretend reading" it! Great for the "hipster that doesn't get science" but who wants to look like the "hipster that gets Advanced Quantum Thermodynamics." Great also - [THE ANNALS OF PRAETACHORAL MECHANICS VOLUME NO. 1 NOW AVAILABLE.](https://www.scq.ubc.ca/the-annals-of-praetachoral-mechanics-volume-no-1-now-available/) - The Science Creative Quarterly is pleased to release its first volume of both a print offering of collected works, AND the much vaulted Annals of Praetachoral Mechanics. This is over 200 pages of creative science writing, including works of fiction, creative non-fiction, a play, humour, poetry, as well as an impressively large section on Wookiees - [PRELIMINARY PHYLOGENY OF MAGICAL AND ORDINARY CREATURES: EVIDENCE OF A RECENT DIVERSIFICATION](https://www.scq.ubc.ca/preliminary-phylogeny-of-magical-and-ordinary-creatures-evidence-of-a-recent-diversification/) - Annals of Praetachoral Mechanics (2016). Vol 2. Advanced online publication. download pdf ABSTRACT We use phloygenetics to accurately describe the relationships between various taxa and elucidate patterns in evolution that leads to the great diversity of life we experience today. The events of "first contact" with the wizarding world has led to a stunning variety - [WHAT IS IN THE JAR?](https://www.scq.ubc.ca/what-is-in-the-jar/) - This is a collaborative poem written by Grade 4 and 5 students on the contents of a “jar.” This jar was a prop that was used to discuss poetry and science, as well as segue into a DIY cloud chamber activity for detection of sub atomic particles. - - - Air, hot, and oxygen and - [FEARBOLA AND THE ALS ICE BUCKET CHALLENGE: HOW SOCIAL MEDIA IMPACTS GLOBAL HEALTH AND SCIENTIFIC RESEARCH](https://www.scq.ubc.ca/fearbola-and-the-als-ice-bucket-challenge-how-social-media-impacts-global-health-and-scientific-research/) - The emergence of social media has drastically changed how people share and receive information. It has also altered how we learn about current events; keep in touch with family and even how we make healthcare decisions. In recent times, social media has also been seen to have a profound impact on global health and scientific - [FIDELITY](https://www.scq.ubc.ca/fidelity/) - (with thanks to Ariel Gomez) “Justus quidem tu es.” – Gerard Manley Hopkins Minus one gene, cells that swing red or green— fascia or hormone— should groan, cease, dissolve to cell-ghost and bone. When staying true would have meant giving death’s due, instead they became something new. When faithfulness to what we knew about what - [DARWIN: BEWARE OF JUMPING THE SHARK](https://www.scq.ubc.ca/darwin-beware-of-jumping-the-shark-2/) - Happy Birthday Darwin! In case, you weren’t yet aware, you’re currently caught in a year for scientific giddiness. A year where a collective hurrah can be heard from those who make it their business to hypothesize, analyze, and formulize. 2009 is the year of Darwin. It’s a double whammy - his 200th birthday, and also - [LIVING ON THE BOUNDARY: EXPLORATION AT THE EDGE OF PHYSICS](https://www.scq.ubc.ca/living-on-the-boundary-exploration-at-the-edge-of-physics/) - Why do we explore? Joel Hutchinson speaks about using the “holographic principle” as an interdisciplinary tool to provide insight into how science and nature actually works together. He believes that by incorporating these innovative approaches to science education, it makes it easier to get people interested in how science impacts the world around them. Filmed - [SIX STORIES](https://www.scq.ubc.ca/six-stories/) - For all the movement it was making, it was very silent. For all the movement around it, it was still very silent. At six stories tall, it is, like most New Yorkers, very slender. No longer green, one immediately knows this one has been around the block for many years. When my mother met my - [THE LOVE SONG OF J. APIS PRUFROCK](https://www.scq.ubc.ca/the-love-song-of-j-apis-prufrock/) - Let us go then, you and I, when the fields are spread with neonicoti(noids) like a bee displayed upon a needle. Let us go then, through certain half-deserted rows of corn that rustles, grows from corporate seed catalogs (all for low-end restaurants with soda and hot dogs). Bees that follow with a tedious hum but - [THE DIABETIC DISASTER](https://www.scq.ubc.ca/the-diabetic-disaster/) - Knock-knock. Knock knock. A pause. Knock-knock… Knockknockknock—KNOCK-KNOCK! Insulina the Insulin Molecule pounded her fist against the door in frustration. She’d tried knocking politely, ringing the doorbell, waiting a minute, and then knocking again with some more doorbell-ringing in between, but the cell simply wasn’t answering. It was unheard of. Cells always responded to hormones, otherwise - [CASTING CALL](https://www.scq.ubc.ca/casting-call/) - Are you: an out of work writer, a devoted YouTube commenter, laboring over a screenplay? Are your Instagram captions two paragraphs long? Do you have a mommy blog? A major cable network (Spike TV) is casting talent for Written Off — A reality show, focused on writing, hosted and judged by supermodel Kate Upton and - [BUTTERFLIES](https://www.scq.ubc.ca/butterflies-3/) - for Julie Bianca Dahl Surgeons in an airport bus are lions at a zoo. They laze, dimly happy to see you. Tails barely flickering in the stagnant savannah air, Khaki pants sticking to pleather seat cushions, They look up only when you mention meat. Their forearms are clean, but you can smell the blood, See - [THE EFFECT OF NOVEL TELOMERASE REVERSE-TRANSCRIPTASE wTERT2 ON THE PATHOGENESIS OF WOOKIEE IDIOPATHIC PULMONARY FIBROSIS](https://www.scq.ubc.ca/the-effect-of-novel-telomerase-reverse-transcriptase-wtert2-on-the-pathogenesis-of-wookiee-idiopathic-pulmonary-fibrosis/) - Annals of Praetachoral Mechanics (2015). Vol 1. pp81 download pdf ABSTRACT The Wookiee population on Kashyyyk is responsible for a majority of the labour workforce in the Mid Rim. Maintaining and improving Wookiee lifespan and productivity is vital for Imperial operations in the area. The long Wookiee natural lifespan of 400 standard galactic years is - [IS THERE A SANTA?](https://www.scq.ubc.ca/is-there-a-santa-3/) - - FROM THE ARCHIVES - Being a scientific investigation of a cultural conundrum Soon it will be Christmas Eve, and once more children will be divided into distinct factions. Here, Cyr [1] described younger children (12 years) who have ditched this ‘childish’ belief. But he - [FORCING THE WOOKIEE. HOW TO BE BOLD BEING BALD.](https://www.scq.ubc.ca/forcing-the-wookiee-how-to-be-bold-being-bald/) - Annals of Praetachoral Mechanics (2014). Vol 1. pp79-87 download pdf ABSTRACT The lack of scientific findings in the biological relationship with the Force has limited the therapies available against Force hypersensitivity to psychological therapy. Our lab has unearthed the first link between the Force-enabling midi-chlorians and a regulated biological process, hair growth. Alopecia areata (AA) - [CHARACTERIZATION OF KASHA-MEDIATED SUSCEPTIBILITY AND HISTOPATHOLOGICAL HALLMARKS OF EARLY-ONSET CHEWHEIMER'S DISEASE](https://www.scq.ubc.ca/characterization-of-kasha-mediated-susceptibility-and-histopathological-hallmarks-of-early-onset-chewheimers-disease/) - Don't forget, this paper is part of a collection of Wookiee scientific reports that will be published in the print edition of the SCQ. More details can be found here. Annals of Praetachoral Mechanics. (2014). Vol 1. pp71-88 pdf download ABSTRACT Since the rise of Force-vector injections (FVIs), the incidence of early-onset CD (eCD) has - [EPISODE 2: UNDERGRADS](https://www.scq.ubc.ca/episode-2-undergrads/) - Regardless of what you’re studying, if you’ve ever been a TA (teaching assistant), you can relate to this episode. Trying to balance research with his TAing responsibilities, Dave encounters that one student we all love to hate – that’s right, the keener. Meanwhile, Steven tries a different approach when training undergrads. What are some interesting - [CANDY HIERARCHY 2014: SUPPLEMENTARY RAW DATA](https://www.scq.ubc.ca/candy-hierarchy-2014-supplementary-raw-data/) - RAW DATA FILE (LINK - xlsx) SOURCES: Cohen B.R. and Ng. D. What are the Best Halloween Candies? Boingboing, October 15th, 2014 - link Cohen B.R. and Ng. D. The Candy Hierarchy 2014. Boingboing, October 31st, 2014 - link ABSTRACT The world renowned "Candy Hierarchy" now enters a new phase of systematics to scientifically measure - [CHAUNCEY BILLINGS SENIOR: AUDIENCE TRANSFORMATION](https://www.scq.ubc.ca/chauncey-billings-senior-audience-transformation/) - Chauncey Billings Senior is a self-made man; and by all accounts a successful one. In his youth his father always reminded him that theirs was a life of modest means. Chauncey Senior wasn’t at the top of his small public school, but by the time he was in college he had developed an unshakeable self-confidence, - [WHAT ARE THE BEST HALLOWEEN CANDIES?](https://www.scq.ubc.ca/what-are-the-best-halloween-candies/) - This is the real reason we dress up like zombies giant bottles of catsup. David Ng and Ben Cohen present a survey to determine your favorites in anticipation of this year's all-important hierarchical delineation of candy goodness. - - - Ranking candy hierarchy is properly and obviously the subject of natural science research. It is - [EPISODE 1: WELCOME TO GRAD SCHOOL](https://www.scq.ubc.ca/episode-1-welcome-to-grad-school/) - It’s the beginning of a new semester. So what does that mean for grad students? Watch episode one of “The Lab” as Dave, a typical PhD student, tries to find a way to balance his research work with his social life. What is it like explaining your research to friends and family? Share your experience - [AND SHE SHOULD](https://www.scq.ubc.ca/and-she-should/) - And she should! she should show, should touch... each such an sheet will she? should touch,... shy, sure. Is a very sharp as he is and is and is and is and IS. and will show which will, each touch. each and is, and will you and your much each such each should should should - [IN WHICH WE INTRODUCE THE ANNALS OF PRAETACHORAL MECHANICS (AND PRESENT A RENEWED CALL FOR SUBMISSIONS)](https://www.scq.ubc.ca/in-which-we-introduce-the-annals-of-praetachoral-mechanics-and-present-a-renewed-call-for-submissions/) - The SCQ is finally pleased to announce a print version of its innards, which will henceforth be referred to as the Annals of Praetachoral Mechanics. The name, of course, is a playful attempt at latinizing the inherent goal of the SCQ - which is to say that it provides science writing and reading options for - [TRANSCRIPTOME DIVERGENCE BETWEEN COMMON AND CAVE-ADAPTED WOOKIEES](https://www.scq.ubc.ca/transcriptome-divergence-between-common-and-cave-adapted-wookiees/) - - - - Annals of Praetachoral Mechanics. (2014). Vol 1. pp7-19 pdf download. ABSTRACT: Cave-adapted organisms commonly evolve convergent morphological, physiological and behavioral traits. The rare cave-adapted wookie species, Wookiee troglodytus, presents an opportunity to characterize underlying evolutionary mechanisms driving phenotypic expression in a complex sentient humanoid. The cave wookie presents several features associated with - [WOOKIEE FOREPLAY: TRANSGENERATIONAL EPIGENETIC REGULATION OF FORCE-SENSITIVITY BY ELABORATE DUET SONG](https://www.scq.ubc.ca/wookiee-foreplay-transgenerational-epigenetic-regulation-of-force-sensitivity-by-elaborate-duet-song/) - Just another reminder that this paper will be published in print format in the fall, along with selected SCQ pieces from the last 7 or so years. If you want to submit your creative science pieces with a mind to make the first issue of this new journal, then please visit here for more information. - [GENETIC BASIS FOR FORCE-SENSITIVITY IN WOOKIEES](https://www.scq.ubc.ca/genetic-basis-for-force-sensitivity-in-wookiees/) - (This is the second paper on a special issue on Wookiee science. You can read the first here). Annals of Praetachoral Mechanics. (2014). Vol 1. pp21-28 pdf download. ABSTRACT Midi-chlorians are sentient life forms, which live in endosymbiosis with all living cells (1). The number of midi-chlorians per cell has been found to correlate with - [HOW TO MAKE A HAIRLESS WOOKIEE: IDENTIFICATION AND FUNCTION OF DE NOVO GLABR GENE IN WOOKIEE WOOKIEE](https://www.scq.ubc.ca/how-to-make-a-hairless-wookiee-identification-and-function-of-de-novo-glabr-gene-in-wookiee-wookiee/) - (This is the THIRD paper on a special issue on Wookiee science. You can read the first here, and the second here). Annals of Praetachoral Mechanics. (2014). Vol 1. pp29-38 pdf download. ABSTRACT We present evidence for the de novo origin of the Wookiee wookiee protein-coding gene GLABR since their divergence from humans. This gene - [TYROSINASE GENE ANALYSIS AND PHENOTYPIC COMPARISON IN WOOKIEES WITH OCULOCUTANEOUS ALBINISM TYPE 1](https://www.scq.ubc.ca/tyrosinase-gene-analysis-and-phenotypic-comparison-in-wookiees-with-oculocutaneous-albinism-type-1/) - (This is the FOURTH paper on a special issue on Wookiee science. You can read the first here, the second here, and the third here). Annals of Praetachoral Mechanics. (2014). Vol 1. pp39-49 pdf download. ABSTRACT Tyrosinase is an enzyme in the melanin biosynthetic pathway. Previous studies have shown that a lack in enzyme activity - [METATRANSCRIPTOME OF GUT MICROBIOTA IN WOOKIEES WITH SEVERE INFLAMMATORY BOWEL DISEASE REVEALS DISTINCT PATHOGENIC COMMUNITY COMPOSITION AND FUNCTIONAL PROFILE](https://www.scq.ubc.ca/metatranscriptome-of-gut-microbiota-in-wookiees-with-severe-inflammatory-bowel-disease-reveals-distinct-pathogenic-community-composition-and-functional-profile/) - Just another reminder that this paper will be published in print format in the fall, along with selected SCQ pieces from the last 7 or so years. If you want to submit your creative science pieces with a mind to make the first issue of this new journal, then please visit here for more information. - [BUTTERFLIES](https://www.scq.ubc.ca/butterflies/) - (for Julie Bianca Dahl) Surgeons in an airport bus are lions at a zoo. They laze, dimly happy to see you. Tails barely flickering in the stagnant savannah air, Khaki pants sticking to pleather seat cushions, They look up only when you mention meat. Their forearms are clean, but you can smell the blood, See - [SHOULD EVERYONE HAVE ACCESS TO LIFE SAVING MEDICINES?](https://www.scq.ubc.ca/accesstomedicines/) - If you're a reader from Canada, don't forget to check out aidsaction.ca. Here, you can look up your candidates and send off an email to support the Call to Action to reform Canada’s Access to Medicines Regime and help save lives! - - - 30 MINUTES, 70 FATES. You don’t know it, but as I - [REASONS WHY IT WOULD BE UNFORTUNATE TO NAME YOUR CHILD “EBOLA”](https://www.scq.ubc.ca/reasons-why-it-would-be-unfortunate-to-name-your-child-ebola/) - He/she is always picked last in gym. All the dumb predictable jokes, as in: “Look, Ebola has just entered the room…” The constant requests to wash his/her hands. The confusion when prospective employers google his/her name. Always being asked to dress up in HazMat gear at Halloween. When travelling, airport security tends to freak. The - [THE QUEST](https://www.scq.ubc.ca/the-quest/) - Once upon a time in the Land of Lab, there was a Princess and two Princes working hard on their Graduate Student projects. One day, the King of the Lab called Princess Jane and Princes John and Robert into his Regal Office. “Tell me,” he said. “How goes the quest in the Lab?” “It goes - [AND GOD SAID, “LET THERE BE DINOSAURS!”](https://www.scq.ubc.ca/and-god-said-let-there-be-dinosaurs/) - Let there be light! Let there be Heaven and Earth! Let there be mortal souls created in Mine own image, gifted with reason and free will… in a bit. First, let there be a bunch of giant fucking monsters everywhere! In My infinite wisdom, I know that populating Earth with millions of Godzillas will be - [RISK ASSESSMENT SONNET](https://www.scq.ubc.ca/risk-assessment-sonnet/) - I can’t keep up with myself. I’ve tried vanes, sun dials, plotting wells. I put a thousand pebbles, feathers, crystals on the shelf – no more scrying with poker chips and shells. The best call at the table is, you lose. The best prediction in life is, you die. So? So what if I cruise - [THE FOUR PILLARS REVISITED (PART 1 OF 5)](https://www.scq.ubc.ca/the-four-pillars-revisited-part-1-of-5/) - Prevention, treatment, harm reduction, and enforcement—Vancouver’s four pillars. It’s the most progressive drug plan of any city in North America. But its authors fear that the pillars are crumbling. This is part one of the Four Pillars Revisited. Our 5-part season-opener, produced by our sister site (terry.ubc.ca) in partnership with The Tyee, and syndicated at - [TATOOINE INTERGOVERNMENTAL PANEL ON CLIMATE CHANGE ASSESSMENT REPORT 1: SUMMARY FOR TATOOINE POLICYMAKERS](https://www.scq.ubc.ca/tipcc/) - I've wanted to do this for a while now. In essence, for the last 5 or so years, Tatooine's binary star system has come up as a talking point in one of my climate change science classes (yes, I'm a Star Wars fan). Basically, I use it to showcase an over-the-top example of radiative forcing. - [NEUROTECH LIGHT AND DARK](https://www.scq.ubc.ca/neurotech-light-and-dark/) - A brain-computer interface controls her robotic arm. As easily as not thinking, she uses it to drink another shot of tequila. I feel a tic escape, as my deep brain stimulation implant remodulates its signal. But I'm not dropping my coffee anymore. The veteran's brain implant doesn't control his PTSD symptoms well, plus he has - [MONSANTO DOES NOT CONDONE CANNIBALISM](https://www.scq.ubc.ca/monsanto-does-not-condone-cannibalism/) - Monsanto does not condone cannibalism. We do not endorse the systematic harvesting of mortal flesh for mass consumption. We do not drool at the thought of rendering a bountiful population of citizens into edible chunks of protein. None of us here fantasize about a future in which the farming of our fellow man is a - [A CLIMATE CHANGE DENIER GETS HEATSTROKE](https://www.scq.ubc.ca/a-climate-change-denier-gets-heatstroke/) - I’m fine, I just need a sip of water. Can I do that without sounding the climate-change alarms? There are four seasons, you guys. Summer’s the hot one. Always has been. I’m just a little thirsty. And, like, a teeny bit dizzy. You can split hairs all you want with statistics about temperatures steadily rising - [I AM RUNNING AN EXPERIMENTAL SCIENCE LAB IN MY HOME](https://www.scq.ubc.ca/i-am-running-an-experimental-science-lab-in-my-home/) - To Whom It May Concern: I am running an experimental science lab in my home. If the naked gentleman ranting around the neighborhood is able to direct you back to my house and you happen upon this letter, rest assured that that is what you found: an experimental science lab. I am a scientist. Not - [COMMON SAYINGS TRANSLATED INTO SCIENTIFICALLY CORRECT STATEMENTS](https://www.scq.ubc.ca/common-sayings-translated-into-scientifically-correct-statements/) - COMMON: Hit the ground running. SCIENTIFIC: Conserve momentum. COMMON: My gut was telling me. SCIENTIFIC: My colon speaks. COMMON: If I had a nickel for every… SCIENTIFIC: x times 5cents, where x equals… COMMON: Don’t throw the baby out with the bathwater SCIENTIFIC: Avoid wet baby head trauma. COMMON: Go the whole 9 yards. SCIENTIFIC: - [ON QUANTUM PARENTING](https://www.scq.ubc.ca/on-quantum-parenting/) - Many adults experience the same suffering, confusion, and joy that quantum physicists have every day. These are the parents of small children — they go through a hard time trying to understand the young, much like a physicist struggling to understand the tiny quantum mechanical systems. To start, you never know what children are thinking - [ANIMAL RESEARCH: THE GOOD, THE BAD, AND THE ALTERNATIVES](https://www.scq.ubc.ca/animal-research-the-good-the-bad-and-the-alternatives/) - Animal research is a very controversial topic that has been generating heated arguments and debates all around the world over the past few decades. Recently, there appears to be an overwhelming growth in animal right groups all over the world. Most of these groups don’t just support animal welfare, but they demand a ban on - [DISCOVERING THE WORLD BENEATH OUR FEET: THE SOIL MICROBIAL ECOLOGIST'S TOOLBOX IN THE AGE OF THE METAGENOME](https://www.scq.ubc.ca/discovering-the-world-beneath-our-feet-the-soil-microbial-ecologists-toolbox-in-the-age-of-the-metagenome/) - It is seven in the morning and your alarm is chirping away, or maybe it’s the morning sun, or the screech of a parent pressed for time. Regardless of the method from which you awake from your slumber, you crawl out of bed and feel that familiar morning growl emanating from your hungry gut. Some - [IT'S A LUCKY THING FOR EVOLUTIONARY BIOLOGY THAT THE FOLLOWING PASSAGES AREN'T IN THE BIBLE](https://www.scq.ubc.ca/its-a-lucky-thing-for-evolutionary-biology-that-the-following-passages-arent-in-the-bible/) - Jesus then entered the farm, and saw creatures of every shape and size, and so said to his followers, "Hey, my Dad made that creature, and that creature, and also that creature… Actually, now that I think about it, he made them all." And at the early dawn of the seventh day, just before He - [IT'S A LUCKY THING FOR EVOLUTIONARY BIOLOGY THAT THE FOLLOWING PASSAGES AREN'T IN THE BIBLE](https://www.scq.ubc.ca/its-a-lucky-thing-for-evolutionary-biology-that-the-following-passages-arent-in-the-bible-2/) - Jesus then entered the farm, and saw creatures of every shape and size, and so said to his followers, "Hey, my Dad made that creature, and that creature, and also that creature… Actually, now that I think about it, he made them all." And at the early dawn of the seventh day, just before He - [ISAAC NEWTON, STANDING ON THE SHOULDER OF GIANTS. EXCERPTS FROM HIS DIARY](https://www.scq.ubc.ca/isaac-newton-standing-on-the-shoulder-of-giants-excerpts-from-his-diary/) - “If I have seen a little further it is by standing on the shoulders of Giants.” Isaac Newton in a letter to his rival Robert Hooke, 1676 - - - May 14th, 1665 Went to the post office today, thinking that I’d be picking up a grant proposal from the Royal Society. Imagine my surprise - [FRACTALS](https://www.scq.ubc.ca/fractals/) - As an artist who has always used natural forms as my subject and began my career by painting Rembrandt-like portraits of white roses, my interest in Chaos Theory and fascination with one of its components – fractals – led to a permanent transformation of my artistic vision. To echo William Blake, I see the world - [ADVICE FOR POTENTIAL GRADUATE STUDENTS](https://www.scq.ubc.ca/advice-for-potential-graduate-students/) - (CLICK HERE FOR PIN-UP POSTER - pdf file ~85k) – We suggest photocopying at 129% - LTR to 11×17 – We currently have room in the lab for more graduate students. But before you apply to this lab or any other, there are a few things to keep in mind. First, be realistic about graduate - [THE BPA DISRUPTOR (A SHORT PLAY)](https://www.scq.ubc.ca/the-bpa-disruptor-a-short-play/) - Scene. An empty lecture hall, stage, or an open space. RACHEL, a scientist researching the impact of bisphenol A on Bantam chickens, has entered a science competition requiring her to act out her research topic in pantomime. Enlisting the help of a friend, CARLSON, to help her with the “dance” performance, CARLSON’S reluctance is countered - [SEEING GRAVITY AND THE (INVISIBLE) UNIVERSE](https://www.scq.ubc.ca/seeing-gravity-and-the-invisible-universe/) - The prediction of gravitational waves, which are the ripples of space and time, is a major theory that many scientists are working hard to confirm. Emmanuel Fonseca talks about how the detection of these waves would uncover previously invisible objects such as black holes and cosmic strings, and may have further important implications. Emmanuel, a - [CANADIAN TRAIN WRECKS OF NOTE](https://www.scq.ubc.ca/canadian-train-wrecks-of-note/) - The Rogers Pass Avalanche, March 4, 1910 The Hinton Train Collision, February 8, 1986 Rob Ford, circa 2006 ongoing The Baptiste Creek Train Wreck, October 27, 1854 Justin Bieber, circa 2013 ongoing The Canoe River Train Crash, November 21, 1950 The St. Hilaire Train Disaster, June 29, 1864 Canadian Environmental and Climate Change Policy, seemingly - [CANCER, A COMIC STRIP: THE ADVENTURES OF CRAFTY UNCONTROLLED MUTANT CELLS.](https://www.scq.ubc.ca/cancer-a-comic-strip-the-adventures-of-crafty-uncontrolled-mutant-cells/) - (Click on images for full size) - [DEATH IS NEARBY](https://www.scq.ubc.ca/death-is-nearby/) - This is a collaborative poem written by Grade 7 students on the contents of a “jar.” This jar was a prop that was used to discuss hypothesis formation, as well as segue into a DIY cloud chamber activity for detection of sub atomic particles. - - - I see a narcissist in the jar. In the jar, - [NIPPING IT AT THE BOOB: THE GATEWAY PROPERTIES OF MOTHER'S MILK](https://www.scq.ubc.ca/nipping-it-at-the-boob-the-gateway-properties-of-mothers-milk/) - Introduction Illicit drug use is a problem that drains public health and medical resources around the world. There are many ways in which we, as a society, can deal with this problem. We may adopt: drug treatment programs in order to get drug users permanently off their drugs; harm reduction programs that have the aim - [HOW TO MANAGE A HOTEL WITH AN INFINITE NUMBER OF ROOMS](https://www.scq.ubc.ca/how-to-manage-a-hotel-with-an-infinite-number-of-rooms/) - It will help to know a little math. We don’t mean fancy math like differential calculus, the Mandelbrot set and Fermat’s Last Theorem. We mean the ability to juggle lists with an infinite number of items in your head without getting dizzy. An appreciation for very large numbers will also be beneficial. Most people have - [WHAT IS IN THE JAR? THE REALLY RANDOM POEM BY DIVISION IV](https://www.scq.ubc.ca/what-is-in-the-jar-the-really-random-poem-by-division-iv/) - This is a collaborative poem written by Grade 5 and 6 students on the contents of a "jar." This jar was a prop that was used to discuss hypothesis formation, as well as segue into a DIY cloud chamber activity for detection of sub atomic particles. - - - There is Adam Sandler leaping over - [I SUSPECT THE I.P.C.C. REPORT MIGHT BE MORE EFFECTIVE IF IT WENT WITH ACRONYMS THAT WERE MORE NARRATIVE IN NATURE.](https://www.scq.ubc.ca/i-suspect-the-i-p-c-c-report-might-be-more-effective-if-it-went-with-acronyms-that-were-more-narrative-in-nature/) - The IPCC report1 The STWBTIPCCFARCC2013TPSB report2 The OWCGWIPCCFR report3 The YIACCAYII report4 The OKSILTRIWSHAGTATTSAAEOTSOCC report5 The BTESCCIRINAGTAAIPOF report6 The OKTIA95LTIOFBTB100ITKOATIPITSR report7 The IOWSAACASCBAT report8 The MYCSTW100CITPRBWAKHTKOSTTTO report9 The SIATITRBYKSIW report10 The FFSJRTGROALTTRACNPOI report11 The ABCIDMOLPCOAGWFDOEICFFIIFFATL report12 The SCTINFSC report13 The AAYWWMLBGOTKOSMTIIBOLWLOMMOTOACISFMAOGEOCI report14 The ASTTQIAYOBWWTIPCCIS report15 The BIYTWTFJGALBB report16 The INWTTARSIIFHSLCHUMCPBTLUIPHBSWGTGWA95CTYCAYCCAGTBMTALDWY report17 1. Intergovernmental Panel on - [ON PIPELINES, OIL, AND RISK: AN FAQ](https://www.scq.ubc.ca/on-pipelines-oil-and-risk-an-faq/) - Note that this was written in April 2013, with an emphasis on the activities around the Northern Gateway pipeline. In late December 2013, the joint review panel recommended that the Federal government approve the pipeline, "with conditions." See this link for more information. THE GLOBAL Q: What is a pipeline? A pipeline is a means - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA!](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza/) - [JUST ANOTHER DAY AT THE LAKE](https://www.scq.ubc.ca/just-another-day-at-the-lake/) - Think of the last time you went swimming. It is summertime at the lake; the little fishes are nibbling your toes and your brother is leisurely floating next to you. The cool, fresh water, having descended from the untouched purity of the frozen Canadian mountain peaks, is your oasis from the summer heat. You are - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 24)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-24/) - CHRISTMAS 1970 (By Spike Milligan) A little girl called Sile Javotte Said ‘Look at the lovely presents I’ve got’ While a little girl in Biafra said ‘Oh what a lovely slice of bread’ (See the whole calendar) - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 23)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-23/) - SANTA BREAKS SILENCE TO DISPUTE RIDICULOUS CLAIMS BY SCIENTISTS THAT HE DOESN’T EXIST (By Murray Brozinsky) For Immediate Release North Pole – December 12, 2011 – Against advice from Mrs. Claus and 62% of the elves, Santa Claus today excoriated what he called the irresponsible and inflammatory rhetoric of overeducated physicists with nothing better to - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 22)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-22/) - THE CHRISTMAS WREATH NEBULA (officially known as Barnard 3, or IRAS Ring G159.6-18.5) More information can be found here. (See previous day) - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 21)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-21/) - IS THERE A SANTA? (By Paul Clarkson) Being a scientific investigation of a cultural conundrum Soon it will be Christmas Eve, and once more children will be divided into distinct factions. Here, Cyr [1] described younger children (12 years) who have ditched this ‘childish’ belief. But he fails, by excluding from his questionnaire, to describe - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 20)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-20/) - THE CELESTIAL SNOW ANGEL (catalogue entry: Sharpless 2-106 | Sh2-106) "The Celestial Snow Angel (catalogued as Sharpless 2-106 or Sh2-106),[2] is an emission nebula and a star formation region in the constellation Cygnus. It is a H II region estimated to be around 2,000 ly (600 pc) from Earth, in an isolated area of the - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 19)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-19/) - O CHEMISTRY GLASSWARE CHRISTMAS TREE, O CHEMISTRY GLASSWARE CHRISTMAS TREE Via ReSyn Biosciences, Avans University of Applied Sciences. (See previous day) - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 18)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-18/) - EXPLODING SNOWMAN VALIDATES (OR DRIVES) CLIMATE CHANGE MODELS (arXiv:1104.0061, By M.S. Brennwald, D.M. Livingstone, R. Kipfer - pdf) Abstract: The B\"o\"ogg is a large model of a snowman, constructed of inflammable materials and filled with explosives. During the traditional festival of Sechsel\"auten, which takes place each spring in Zurich, Switzerland, the B\"o\"ogg is placed atop - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 17)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-17/) - SANTA AND THE MOON (Peter Barthel, Communicating Astronomy to the Public, May 2012, (12) p13 – 15) Link to journal | link to arxiv abstract | link to pdf Abstract: This article reflects on the use of illustrations of the Moon in images of Santa Claus, on Christmas gift-wrapping paper and in children’s books, in two countries which have - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 16)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-16/) - A SANTA CLAUS AS INTRUDER ALERT SYSTEM (By Thomas Cane) (See previous day) - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 1)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-1/) - THE CHRISTMAS TREE CLUSTER IN NGC2264. (Look carefully, it's inverted). "NGC 2264: Cone Nebula at bottom with inverted Christmas Tree cluster above the cone; the bright star just above the cone is the tree topper and the very bright star at the top of the image (S Monocerotis) is the center of the tree trunk. - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 15)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-15/) - GEEKY LABORATORY CHRISTMAS PLAYS (Collected works by Vince Li-Cata) IT’S A DEBATABLE CHRISTMAS Hello, Hello Everyone, and welcome to the Special Christmas Edition of The Sean Connery Show. I’m your host. You know, of course, me as the star of Zardoz and Dragonheart, but my friends just call me Sir Sean Connery. Thank you, thank you – please - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 14)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-14/) - DARWIN AS SANTA (a.k.a. one way Darwin Could Jump the Shark) “Sporting his full white beard, Darwin is hired to impersonate Santa Claus at the local mall. He initially does well in this job, looking the part, being punctual, amicable, and knowledgeable about reindeer. However, he soon begins to insist on teaching children words like - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 13)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-13/) - IMAGES IN CHRISTMAS BALLS: A.K.A. CRAZY OPTICS CALCULATIONS (By Eef van Beveren, Frieder Kleefeld, George Rupp | pdf) Figure 6: The locations of the various images as seen by each of the five observers introduced in Fig. 1. We also indicate the angles of incidence and reflection, in order to make sure that they are equal. Abstract: We - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 12)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-12/) - An Administrative Approach from Santa Claus and Stork (JE May; CR Ribeiro; F Belini) Abstract: As a public domain, the Santa Claus is able to deliver in a single night million of products in different places in the entire world. On the other hand, the Stork also deliver a million of products a day but - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 11)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-11/) - ANIMATED GIF OF A GROWING SNOWFLAKE (By Kenneth G. Libbrecht, via Snowcrystals.com) (See previous day) - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 10)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-10/) - PRETTIEST CHRISTMAS LIGHTS EVER (Animated gifs of epithelial cells doing the mitosis) Just staring at this makes us think about the brilliance of nature. Just consider the complexity of what’s going on during mitosis – you have a genome, compartmentalized with chromosomes, doubling. Then, you have a perfect splitting of the two copies into two - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 9)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-9/) - AWESOME MICROBIAL CHRISTMAS ART! Fungal plates by Stephanie Mounaud: Bacterial plates by Niall Hamilton. Fungal Christmas tree. Top: Talaromyces stipitatus; Tree: Aspergillus nidulans; Ornaments: Penicillium marneffei; Trunk: Aspergillus terreus. - - - - - - - - - Fungal snowman. Hat, Eyes, Mouth, Buttons: Aspergillus niger; Arms: Aspergillus nidulans; Nose: Aspergillus terreus with Penicillium marneffei; Body: Neosartorya - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 8)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-8/) - SNOWMAN SCIENCE (Courtesy of Calvin and Hobbes, by Bill Watterson) (See previous day) - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 7)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-7/) - NITROGEN INCREASES FRESH WEIGHT AND RETAIL VALUE OF FRASER FIR CHRISTMAS TREES (As measured by number of buds as well as weight, length, and surface area of needles) Hinesley L.E. et al. HORTSCIENCE 35(5):860–862. 2000. Abstract. Abies fraseri (Pursh) Poir. Christmas trees were fertilized for 5 years with four levels of N (0, 56, 113, - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 6)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-6/) - HEIGHT OF CHRISTMAS TREE DRAWINGS AS A FUNCTION OF TIME: THE STUDY (Conclusion: the drawings get bigger at xmas time) Summary. Thirty male and 30 female srudents in Grade 6 of a local public school were asked to draw Christmas Trees on October 31, November 28, December 19, January 13, February 13, and March 13. - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 5)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-5/) - MARVELOUS CHRISTMAS CARD BY ROY DOTY (The most awesome Rube Goldberg Machine ever!) By Roy Doty, 2006. Click on the image for full size goodness. (See previous day) - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 4)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-4/) - IN WHICH WE DETERMINE A GENETIC BASIS FOR THE GRINCH PHENOTYPE. (Something about G-protein signalling and a heart, two sizes too small) Scott I.C. et al. Dev Cell. 2007 Mar;12(3):403-13. Figure 1. The grns608 Mutation Affects Cardiomyocyte Specification: (A and B) Lateral views of 48 hpf embryos from grns608 heterozygote incrosses. In severe cases, mutant - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 3)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-3/) - IN WHICH WE ARE TOLD WHY RUDOLPH’S NOSE IS RED. “Epidemiology of reindeer parasites.” Halvorsen O. Parasitol Today. 1986 Dec;2(12):334-9. ABSTRACT: Every Christmas we sing about Rudolph the red-nosed Reindeer, but do we give much thought to why his nose is red? The general consensus is that Rudolf has caught a cold, but as far - [SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA! (DAY 2)](https://www.scq.ubc.ca/sciencegeek-advent-calendar-extravaganza-day-2/) - VINTAGE BIODIVERSITY IMAGES WITH CHRISTMAS TWIST. (Beautifully done). By Ruth Bleakly, and available for sale as Christmas cards at Concertina Press (See previous day) - [THIS. THE END OF SCIENCE.](https://www.scq.ubc.ca/this-the-end-of-science/) - [IDENTIFICATION OF HUMAN CHROMOSOME γ AND ITS EPIGENETIC CONTROL FOR THE EXPRESSION OF "SUPER" GENES](https://www.scq.ubc.ca/identification-of-human-chromosome-γ-and-its-epigenetic-control-for-the-expression-of-super-genes/) - - - - New England Journal of Medicine. (March 2013). Vol 328 No 12. DOI: 10.1738/NEJMoal219833 - pdf download ABSTRACT BACKGROUND Superheroes possess exceptional characteristics that far exceed the scope of human capabilities, such as the tremendous strength and pigmentation observed in The Incredible Hulk following his exposure to γ-radiation. Here, we explore the underlying - [IF THERE IS ANYBODY OUT THERE: HOMO SAPIEN HAIKU](https://www.scq.ubc.ca/if-there-is-anybody-out-there-homo-sapien-haiku/) - If you find us, run. Because we will not make peace. We only know war. We will capture you, Examine and dissect you. If we fear you, hide. Because fear drives us to exterminate the source. We are small-minded. I apologise On behalf of my species, For our ignorance. - [Oil Tanker Spills: An FAQ](https://www.scq.ubc.ca/oil-tanker-spills-an-faq/) - GLOBAL SIGNIFICANCE OF THE ISSUE What are oil tankers? Oil tankers are ocean vessels that transport petroleum oil (10). Petroleum is a liquid mixture composed of hydrocarbons and is mainly used to produce gasoline (10). Tankers can transport crude oil from oil extraction sites, such as tar sands, to refineries (11). Alternatively, they can transport - [STUDENTS TRY TO SPEAK TO A FEDERAL SCIENTIST: THEY FAIL. ON THE MUZZLING OF CANADIAN SCIENCE.](https://www.scq.ubc.ca/students-try-to-speak-to-a-federal-scientist-they-fail-on-the-muzzling-of-canadian-science/) - What if there was a non-political research project that involved a collaboration between NASA scientists and Environment Canada scientists? How easy would it be for a journalist to talk to the scientists involved? It turns out it would take only 15 minutes for something to be arranged with NASA. With Environment Canada, however, it would - [METAGENOMIC METHODS REVEAL MARVELOUS MICROBIAL MICROCOSMS](https://www.scq.ubc.ca/metagenomic-methods-reveal-marvelous-microbial-microcosms/) - Do you know how many different kinds of microbes exist on Earth? It may sound like a silly question but please indulge me and try to come up with a number… ready for the answer…? I hate to disappoint you but… it turns out that we still do not know! For most of the twenty-first - [ANNOUNCING THE "VOYAGE OF THE BEAGLE" TRADING CARD GAME. PLUS A CALL FOR SOME CROWDSOURCED GOODNESS!](https://www.scq.ubc.ca/announcing-the-voyage-of-the-beagle-trading-card-game-plus-a-call-for-some-crowdsourced-goodness/) - The Phylo project is hard at work on preparing the next high quality Phylomon* deck, and this one will revolve around Charles Darwin and his wonderful 5 year voyage on the H.M.S. Beagle. At this point in time, we've enlisted the help of noted Darwinian aficionado, Karen James, who has nicely narrowed down the - [SACRED WASTE: A POLYMERIC RITUAL AT THE NEW ORLEANS FRINGE FESTIVAL](https://www.scq.ubc.ca/sacred-waste-a-polymeric-ritual-at-the-new-orleans-fringe-festival/) - I have a small part in a show called SACRED WASTE which was created by LSU Ph.D. student Bonny McDonald – which is playing in the upcoming New Orleans Fringe Fest. The show involves dance, poetry, ritual, elaborate costumes (made of 100% recycled plastic), and explores many aspects of the relationship between humans and plastic - [THE 2013 CANDY HIERARCHY - A SCIENCE CREATIVE QUARTERLY PIN UP (NO. 6)](https://www.scq.ubc.ca/the-2013-candy-hierarchy-a-science-creative-quarterly-pin-up-no-6/) - Click on the image for larger graphic. - - - (CLICK HERE FOR PIN-UP POSTER – pdf file ~1Mb) – We suggest photocopying at 129% – LTR to 11×17 – - - - ABSTRACT The “Candy Hierarchy” represents a thoroughly authoritative attempt to scientifically measure and classify Halloween Candy by assessing “joy induction.” More or - [UPREGULATED MEMBRANE EXPRESSION OF A CONSERVED VOLTAGE-GATED SODIUM CHANNEL, Nav1.4a AND ELECTRICAL ORGAN DISCHARGE IN ELECTRIC MOUSE, P. pikachu](https://www.scq.ubc.ca/upregulated-membrane-expression-of-a-conserved-voltage-gated-sodium-channel-nav1-4a-and-electrical-organ-discharge-in-electric-mouse-p-pikachu/) - - - - PLOS BIOLOGY (March 2013). Vol 11 Issue 3. e1001501 p1-6 pdf download ABSTRACT Electrocytes contain membrane proteins that allow the polarization of the plasma membrane, thereby allowing the generation of electricity in animals. It has been long established how electricity is generated in the electric eel, but recent studies found similar electrocytes to - [PHYLOGENY HAIKU ON THE GREAT APES](https://www.scq.ubc.ca/phylogeny-haiku-on-the-great-apes/) - Pongo abelii Orangutan asks Why only use my two hands? Feet are just as good Pongo pygmaeus Orangutan climbs A good distance away from African great apes Gorilla gorilla Gorilla ponders When brute force fails to resolve Perhaps more force works Gorilla beringei Mountain gorilla Calmly chews wild celery Peaceful times are rare Pan paniscus - [PIECE OF MINE: A CONFLICT MINERALS FAQ](https://www.scq.ubc.ca/piece-of-mine-a-conflict-minerals-faq/) - What are conflict minerals? Conflict minerals are natural resources whose illegal exploitation and trade in a context of war make millions in revenue for armed groups who in turn use these funds to purchase weapons that fuel violence and perpetuate human rights abuses. The UN General Assembly first officially discussed the concept in relation to - [SENILE MIOSIS](https://www.scq.ubc.ca/senile-miosis/) - The pupils of the eye become smaller as we age, shrinking to a mere third of their robust, youthful size. You knew this, even if you were not aware of the vanishing look in your grandmother’s window, the reptilian ooze of warm blood over the cliff. Open wide. Please. Open wider, so that we might - [I'M STILL PROUD EVERY TIME I TIE MY SHOES](https://www.scq.ubc.ca/im-still-proud-every-time-i-tie-my-shoes/) - Scientific inquiry can be driven by a variety of motives. Certainly the quest to cure cancer can be a matter of wanting to simply help, but even anger, frustration, or grief can be involved. Recently, I saw a news story of a researcher who forged results for new cures, exposing patients to dangerous treatments for - [CLEAVAGE OF SUPERPOWER PROTEIN DETERMINES THE SUPERPOWER PHENOTYPE IN A TISSUE DEPENDENT MANNER: HOW INCREDIBLE!](https://www.scq.ubc.ca/cleavage-of-superpower-protein-determines-the-superpower-phenotype-in-a-tissue-dependent-manner-how-incredible/) - JOURNAL OF SUPERHERO RESEARCH (2013). Vol 13 Vol 547. pp328-3332 doi:23.1724/SR20130328 pdf download We demonstrated that the presence of superpower (SP) protein cleavage is responsible for the diversity of superpowers in a tissues-specific manner within The Incredibles family. This cleavage event produces two fragments, 135 kDa and 85 kDa, without a loss of peptide, as - [I DO NOT MEAN TO BRAG, BUT I AM A SCIENTIST](https://www.scq.ubc.ca/i-do-not-mean-to-brag-but-i-am-a-scientist/) - Hello! Nice to meet you. Before we begin this conversation, I have to ask: are you a scientist? Oh. Okay. This might be hard, then. You see, I am a scientist, and it will be difficult for me to talk to you, a layperson, without seeming like I am tooting my own horn, as you - [ASK NOT WHAT YOUR URBAN FOREST CAN DO FOR YOU...](https://www.scq.ubc.ca/ask-not-what-your-urban-forest-can-do-for-you/) - It’s time that we upped the ante on the level of public discussion on the urban forest. What is the urban forest you ask? Well it’s those pleasant remnant stands of forest that speckle the urban landscape, like Vancouver’s Stanley Park – but it’s also every other tree in the city, from that old oak - [HOWLETT: NOVEL WOLVERINE PROTEIN CONTRIBUTES TO RAPID REGENERATION AND HEIGHTENED CELLULAR REPLICATION](https://www.scq.ubc.ca/howlett-novel-wolverine-protein-contributes-to-rapid-regeneration-and-heightened-cellular-replication/) - JOURNAL OF SUPERHERO MUTATIONAL SCIENCE (February 2013). Vol 13 Issue 2. pp297-302 pdf download Wolverine, a mutant from the X-men team, possesses super healing abilities. Wolverine’s healing abilities have striking similarities to that seen in axolotl, an amphibian with the capacity to regenerate amputated limbs. In this study we sought to determine the mechanisms by - [EVEN JELLYFISH DESERVE A HAIKU](https://www.scq.ubc.ca/even-jellyfish-deserve-a-haiku/) - Stinging medusa Aurelia aurita Lunar Translucence - [WHO'S THE CUTEST RATTLESNAKE?](https://www.scq.ubc.ca/whos-the-cutest-rattlesnake/) - After passing me a beer from the fridge, Kimberly led me to the snakes, which were contained in forty-gallon Rubbermaid bins in her living room. I sat down while she shifted the bins to clear a place on her floor where she and her colleague Jayme could work. As soon as she moved the bin, - [THE ABRAMS' STORMTROOPER AXIOM](https://www.scq.ubc.ca/the-abrams-stormtrooper-axiom/) - It (hypothetically*) goes like this: * Like all good science, this needs some testing... - - - When news hit that Disney bought the rights to Star Wars, and that J.J. Abrams would be manning the first movie of a new trilogy, my inner geek went into giddy overdrive. This was because it gave me - [WHEN WHEAT MUFFINS TURN TO THE DARK SIDE: ON GLUTEN AND YOUR DIET](https://www.scq.ubc.ca/when-wheat-muffins-turn-to-the-dark-side-on-gluten-and-your-diet/) - (Published March 2013) Think about what you ate for breakfast this morning. You might have had some fruit or protein, but you most likely ingested wheat. This is a probable assumption because wheat is the most widely consumed food group in the North American diet [1]. Common wheat-based breakfast foods such as pastries, bagels, granola - [TRAMPING THE CELESTIAL SPHERE: IN WHICH, I, THE PROTAGONIST, DO TRAVEL ACROSS OUR DOMAIN FOR YOUR PLEASURE](https://www.scq.ubc.ca/tramping-the-celestial-sphere-in-which-i-the-protagonist-do-travel-across-our-domain-for-your-pleasure/) - I lay in the grass one day, counting the number of blades within a modest area, when I decided to try something. I stuck my foot out in the open air and probed a bit, and felt a precarious platform. Ah, there it is, I can walk on light. How convenient! Probing with my other - [PRELIMINARY DATA FROM THE UNICORN GENOME: THE FIRST POSSIBLE INDICATION IN HISTORY OF MAMMALIAN EVOLUTION OF HYBRIDIZATION ACROSS ORDERS](https://www.scq.ubc.ca/preliminary-data-from-the-unicorn-genome-the-first-possible-indication-in-history-of-mammalian-evolution-of-hybridization-across-orders/) - Journal of Fantastic Phylogenetics 2012 8(9): 42-49 Authors: Jean-Pierre Marielle III & Justin Case | pdf version In this study we present the preliminary finding of what could be the first record in history of hybridization between mammalian Orders (Perissodactyla and Cetacea). Phylogenetic analyses from the unicorn (Equus unicornus) mitochondrial genes (protein-coding Cytochrome b, Cytb) - [THE WONDERFUL WORLD OF ORCHID LOVE](https://www.scq.ubc.ca/the-wonderful-world-of-orchid-love/) - Do you ever think about plant sex? I still remember walking into the first class of my first ever plant biology course during my undergraduate degree and my professor introducing himself as just another botanist who is obsessed with plant sex. At the time I thought my professor was a quirky guy trying to get - [TIS THE SEASON, SO WHY NOT A SCIENCEGEEK ADVENT CALENDAR EXTRAVAGANZA!](https://www.scq.ubc.ca/tis-the-season-so-why-not-a-sciencegeek-advent-calendar-extravaganza/) - For those who'd like to open a different kind of advent calendar. Check out our little nuggets of science-y goodness, by clicking the below to see what's been revealed (or click here to follow along) - [A moment of your time: about Bill C-398 and how Canadians can contribute to global health](https://www.scq.ubc.ca/a-moment-of-your-time-about-bill-c-398-and-how-canadians-can-contribute-to-global-health/) - Dear Canadians: On wednesday, a very important piece of policy will be discussed in parliament. It's called Bill C-398 and it deserves our attention. It seems that it has been challenging for some to see its merits, and so, I'd like to take moment to clarify what it's all about. It turns out that - [HOW TO THINK ABOUT ETERNITY](https://www.scq.ubc.ca/how-to-think-about-eternity/) - Thinking about eternity is not simply an esoteric mental exercise. It’s a cure for boredom, a panacea for the trivial, a respite from the mundane. And it’s the sort of thinking best done on your own. If you say to your spouse, “Let’s stay in tonight and bat around the notion of eternity,” chances are - [WRITE EN MASSE TO CANADA'S MEMBERS OF SENATE AND TELL THEM TO PASS BILL C-393](https://www.scq.ubc.ca/write-en-masse-to-canadas-members-of-senate-and-tell-them-to-pass-bill-c-393/) - To help in reaching our honourable Senators, please find their email addresses, in alphabetical order, comma separated (for copy+pasting in the To: box) below: andrer@sen.parl.gc.ca, anguswd@sen.parl.gc.ca, bakerg@sen.parl.gc.ca, gautht@sen.parl.gc.ca, boisvp@sen.parl.gc.ca, braled@sen.parl.gc.ca, brazep@sen.parl.gc.ca, brownb@sen.parl.gc.ca, callbc@sen.parl.gc.ca, campbel@sen.parl.gc.ca, carigc@sen.parl.gc.ca, carsts@sen.parl.gc.ca, champa@sen.parl.gc.ca, chapum@sen.parl.gc.ca, cochre@sen.parl.gc.ca, comeag@sen.parl.gc.ca, coolsa@sen.parl.gc.ca, cordyj@sen.parl.gc.ca, cowanj@sen.parl.gc.ca, dallar@sen.parl.gc.ca, dawsod@sen.parl.gc.ca, dayja@sen.parl.gc.ca, debanp@sen.parl.gc.ca, tessil@sen.parl.gc.ca, dininc@sen.parl.gc.ca, johnse@sen.parl.gc.ca, pdowne@sen.parl.gc.ca, mikeduffy@sen.parl.gc.ca, dyckli@sen.parl.gc.ca, eatonn@sen.parl.gc.ca, egglea@sen.parl.gc.ca, - [WAITING TO INHALE: WHY IT HURTS TO HOLD YOUR BREATH](https://www.scq.ubc.ca/waiting-to-inhale-why-it-hurts-to-hold-your-breath/) - Quick! Take a breath and try to hold it. If you reach 11 minutes and 35 seconds, congratulations! You are now tied for the world record. For most of us the ability to hold our breath lasts 30 seconds, maybe even 1 or 2 minutes. Much longer than that and the sensation that your lungs - [ONE MUST PUBLISH](https://www.scq.ubc.ca/one-must-publish/) - “Whereof one cannot speak, thereof one must publish.” - Wittgengenerator 2.0 As we all know, boys and girls, the mechanical industrialization of philosophy was an unqualified boon to academic productivity. It is hard to believe, indeed, that Once Upon a Time there were merely a few hundred journals published by a few thousand academicians toiling - [BAD SCIENCE: THE PSYCHOLOGY BEHIND EXAGGERATED AND FALSE RESEARCH](https://www.scq.ubc.ca/bad-science-the-psychology-behind-exaggerated-and-false-research/) - Click on image for full size. - - - Note that the original graphic lives at http://www.clinicalpsychology.net/bad-science/ - [AM I EVERYWHERE?](https://www.scq.ubc.ca/am-i-everywhere/) - Last year, I had a decidedly Jungian experience, which is odd for me as a rational scientific sort. This synchronicity event happened at a local bookstore where I was searching for an issue of a Canadian magazine called Maisonneuve, a publication nice enough to print an essay of mine. As I was looking over the - [IT’S A DEBATABLE CHRISTMAS](https://www.scq.ubc.ca/it’s-a-debatable-christmas/) - Characters (in order of appearance) Sean Connery Her Man Pain Michele Bachward Katy Perry’s Dad Moot Romney Newt Vader Santa HOST Hello, Hello Everyone, and welcome to the Special Christmas Edition of The Sean Connery Show. I’m your host. You know, of course, me as the star of Zardoz and Dragonheart, but my friends just - [SANTA BREAKS SILENCE TO DISPUTE RIDICULOUS CLAIMS BY SCIENTISTS THAT HE DOESN'T EXIST](https://www.scq.ubc.ca/santa-breaks-silence-to-dispute-ridiculous-claims-by-scientists-that-he-doesnt-exist/) - For Immediate Release North Pole – December 12, 2011 – Against advice from Mrs. Claus and 62% of the elves, Santa Claus today excoriated what he called the irresponsible and inflammatory rhetoric of overeducated physicists with nothing better to do than employ fancy mathematical equations in an effort to deny children a sense of wonder. - [BAD ASS POKEMON (I MEAN PHYLOMON) CARDS. LOOKING TO HIRE SOME ARTISTS](https://www.scq.ubc.ca/bad-ass-pokemon-i-mean-phylomon-cards-looking-to-hire-some-artists/) - Just saying that biodiversity isn't all about beauty and things being cute and cuddly. These cards at the Phylogame website rock! And in case, you're new to the Phylomon idea, it's basically a crowdsourced art, science and gaming project that revolves around the reality of children knowing WAY more about Pokemon than they do about - [MERMAID EXPLAINS YOUR TONGUE TO YOU](https://www.scq.ubc.ca/mermaid-explains-your-tongue-to-you/) - The mermaid’s eyes bulge from the sides of her head, one aimed at you, one at the lead-colored sea. You cross your eyes; “No fair,” she says, and wheezes a little laugh; her breasts lift, ribs out, ribs gone again, skin shining and white like a porcelain platter wet in the sink. You want to - [THE DIGESTIVE SYSTEM AS TAUGHT BY A PLUMBER](https://www.scq.ubc.ca/the-digestive-system-as-taught-by-a-plumber/) - The shortage of qualified surgeons in this country has led to drastic measures being taken. Here is a transcript of a lecture given recently to new surgical interns by Master Plumber Fred Johnson of Johnson’s Plumbing and Heating. “Let’s go over the design plans briefly before we begin our operation, fellas.” “We’ll proceed from the - [LIFE IN FORMALDEHYDE AND ALAS! POOR YORICK](https://www.scq.ubc.ca/life-in-formaldehyde-and-alas-poor-yorick/) - Science is beautiful. Art is beautiful. There is a schism in our cultural consciousness: the humanities and sciences have been separated, and you have to choose a side and then be intimidated by the other. I want to present science in a way that its visual beauty is apparent, I want to present art to - [LET ME TELL YOU ABOUT JOHN MICHAEL GRIFFIN, JR.](https://www.scq.ubc.ca/let-me-tell-you-about-john-michael-griffin-jr-2/) - - FROM THE ARCHIVES - Griff, as he was known in high school, was a friend of mine. In fact, late in the first half of our lives, he stood up for me physically and philosophically, for being a science geek. Truth is, John's endorsement was the first time I was ever deemed cool for - [THE SCIENCE/ARTS DIVIDE STANDS BETWEEN US: A LOVE STORY](https://www.scq.ubc.ca/the-sciencearts-divide-stands-between-us-a-love-story-2/) - “Tell me something interesting,” he says to me as we sit side by side on the bus. He looks so cold and calculated and I wonder if he feels anything towards me at all. He takes up room in his seat. I barely fit next to him. He is an overachiever, overeducated and impeccably self-reliant, - [POLIO: A VIRUS' STRUGGLE](https://www.scq.ubc.ca/polio-a-virus-struggle-5/) - - FROM THE ARCHIVES - Download the pdf (14pages, ~2.7Mb) - [PHOTO OF A NICE SET OF BOOBIES WE SAW AT THE MUSEUM OF NATURAL HISTORY](https://www.scq.ubc.ca/photo-of-a-nice-set-of-boobies-we-saw-at-the-museum-of-natural-history-4/) - * * * (REPRINTED FROM ISSUE ONE, APRIL 11th, 2005) - [THE BESTEST, MOST KICK ASS, HUMAN GENOME PROJECT](https://www.scq.ubc.ca/the-bestest-most-kick-ass-human-genome-project-4/) - - FROM THE ARCHIVE - Mondo-Genetic-Services is proud to announce its latest venture, “The Bestest, Most Kick Ass, Human Genome Project.” Hot on the tails of the International Human Genome Sequencing Consortium and Celera Genomics, we present to you a novel approach in the elucidation of mankind’s blueprint of life. Rather than using the frequently - [HOW I GOT OUT OF WRITING AN ESSAY ON H.G. WELL'S THE TIME MACHINE.](https://www.scq.ubc.ca/how-i-got-out-of-writing-an-essay-on-h-g-wells-the-time-machine/) - - FROM THE ARCHIVES - January 17, 2005 I received the syllabus for my Humanities course. A humanities course should not be required for my B.Sc degree in Physics. To add insult to injury, we are supposed to do an analysis of Well’s The Time Machine. We are to focus on the historical context when - [A DIALOGUE WITH SARAH, AGED 3: IN WHICH IT IS SHOWN THAT IF YOUR DAD IS A CHEMISTRY PROFESSOR, ASKING “WHY” CAN BE DANGEROUS](https://www.scq.ubc.ca/a-dialogue-with-sarah-aged-3-in-which-it-is-shown-that-if-your-dad-is-a-chemistry-professor-asking-“why”-can-be-dangerous-5/) - SARAH: Daddy, were you in the shower? DAD: Yes, I was in the shower. SARAH: Why? DAD: I was dirty. The shower gets me clean. SARAH: Why? DAD: Why does the shower get me clean? SARAH: Yes. DAD: Because the water washes the dirt away when I use soap. SARAH: Why? DAD: Why do I - [TRASH TALKIN' AT THE AQUARIUM](https://www.scq.ubc.ca/trash-talkin-at-the-aquarium-4/) - Wut up, tortoise? You think you're all that 'cause you can swim really well and stuff? Well, sorry to disappoint you, son, but I can swim really well, too. Sucka. I need to wear water wings, on account I'm scared of deep water, but that's still swimming. So bite me, fool. Ooo, shark, what big - [AFRICAN LION FAMILY OBJECTS TO THEIR PORTRAYAL IN RECENT DISCOVERY CHANNEL DOCUMENTARY](https://www.scq.ubc.ca/african-lion-family-objects-to-their-portrayal-in-recent-discovery-channel-documentary-4/) - - FROM THE ARCHIVE - Papa Lion (Carl) First off, that tree we were lying around in the shade by, that wasn’t even our tree. The producers literally brought in that tree and told us it was going to be our new tree. They said our tree—the tree we’ve lay under for years—“didn’t have a - [MY MASSIVE ROBOTIC NASA ARM](https://www.scq.ubc.ca/my-massive-robotic-nasa-arm-6/) - - FROM THE ARCHIVES - 1 Went to the mall today. Bought some boxer briefs and an Icee. Stopped into the arcade and lost to some punk kid at Street Fighter II. It's hard for me to push the buttons at the right time. Shuttle Remote Manipulator Prostheses (SRMP) destroyed Street Fighter machine. 2 Saw - [A BRIEF HISTORY OF MY ON-GOING LOVE AFFAIR WITH SCIENCE](https://www.scq.ubc.ca/a-brief-history-of-my-on-going-love-affair-with-science-5/) - - FROM THE ARCHIVES - May 8th, 1988 I encounter science for the first time during recess. As my friends and I are busy using the magnifying lens that Billy Stewart had gotten for his eighth birthday to burn some sticks, she breaks off from the pack of girls she usually travels around the schoolyard - [BUTTERFLY](https://www.scq.ubc.ca/butterfly-3/) - This piece is copyrighted (2004), Chris Ware, and reprinted with permission from McSweeney's Quarterly Concern Issue 13 - [FACT OR FICTION: TARDIGRADES](https://www.scq.ubc.ca/fact-or-fiction-tardigrades/) - 1. Tardigrades feed on plants and bacteria. Fact. The majority of tardigrades subsist on plant matter and bacteria, although some species will occasionally eat entire organisms, such as rotifers. 2. Tardigrades are cute. Fiction. Tardigrades are not cute; they’re short and overweight, with poorly articulated limbs and claws on their feet. Their bodies are covered - [SURVIVAL OF THE FITTEST](https://www.scq.ubc.ca/survival-of-the-fittest/) - (Re: In the continued debate over high school science textbooks in Louisiana, whereby a local opponent of evolution, Judge Darrell White, insisted on connecting the Columbine High School massacre to the teaching of evolution through the phrase "survival of the fittest.") - - - When we summarize things we have to be careful that we - [POLLOCK'S LAST SNOWFLAKE](https://www.scq.ubc.ca/pollocks-last-snowflake/) - The question posed a voluptuous riddle. Were these frenzied silhouettes pole-dancing in black and blue drooling the white slip the sinewy gestures of Jackson Pollock's dribble? The answer coveted in a cracked glass where crystalline veins erupt like snowflakes fatally flirting with windowpanes. The anonymous physicist found relying on African fractals and reflexive theories of - [WHY ARE WE HERE? A PERSPECTIVE BASED ON INTELLIGENT DESIGN AND GAIA THEORY](https://www.scq.ubc.ca/why-are-we-here-a-perspective-based-on-intelligent-design-and-gaia-theory/) - 1. Introduction: Perhaps one of the most profound problems of philosophy is the age-old question of why we exist- here, on Earth, in the short time period which has been allotted to humankind. It probably concerned our prehistoric ancestors: we know it has occupied philosophers from at least the time of Aristotle to the present. - [LOVE AND DEATH AT THE NIH](https://www.scq.ubc.ca/love-and-death-at-the-nih/) - I first started experimenting with watercolor about 10 years ago, and from the beginning got into “wet in wet technique.” To paint “wet in wet” you paint a base color and then add other colors to it while it’s still wet. This allows the different colors to bleed into each other, making interesting patterns. People - [ARHYTHMETIC](https://www.scq.ubc.ca/arhythmetic/) - these three remainders you, me and her are the legacy of simple math and boolean logic, not so much we have lost our ability to add and multiply desire sliding slowly off the tail end of X crossed paths in a cradle of American comforts so many plus signs weighed us down there is no - [DOODLING DROOLING MACROPHAGES](https://www.scq.ubc.ca/doodling-drooling-macrophages/) - Drawing ludicrous cartoons to memorize scores of gory scientific details has always been an incredible pastime for me. After all, why study off of stacks of flashcards with miniscule writing on them when you can study off pictures instead, as well as have a jolly time envisioning the crazy things you drew while writing the - [QUANTUM GASTRONOMY](https://www.scq.ubc.ca/quantum-gastronomy/) - We can safely proclaim that, in the twenty-first century kitchen, ''molecular gastronomy'' is passé. Ever since Barbara Lynch unveiled a neutrino-infused chocolate ganache earlier this year, the trend in fine dining has been decidedly subatomic. While we owe a great debt of gratitude to the flour-dusted shoulders upon which we have stood, it behooves us - [SLICK CITY: THE PITCH](https://www.scq.ubc.ca/slick-city-the-pitch/) - Alright everyone, you know it’s high time for some major spin control. We may have managed to plug that baby up, but now we’ve got to fight that public relations fight. Ha ha - who would have thought that 4.9 million barrels of crude oil spilling out would piss so many people off? But seriously, - [EPISODE 5.5: A JEDI WINTER SESSION](https://www.scq.ubc.ca/episode-5-5-a-jedi-winter-session/) - (Wherein the Empire of State Government attacks the Academic Alliance) Characters: Darth Governor (feel free to replace “Governor” with the name of your state’s Governor) Senator Professor Leia Dean Luke Chancellor Yoda The Emperor Queen Amadala - - - Darth Governor and a Senator enter (Darth Vader music). Darth Governor: The Academic Alliance has thwarted - [SCIENCE'S BEST JOKESTERS](https://www.scq.ubc.ca/sciences-best-jokesters/) - "The most exciting phrase to hear in science, the one that heralds the most discoveries, is not 'Eureka! but 'That's funny!'" -Isaac Asimov - - - Science's best prank call In 1875 after years laboring to create the first working telephone, Alexander Graham Bell successfully called Thomas Watson. Watson picked up the receiver and heard - [BOILING LOBSTERS AND OTHER THINGS PEOPLE DO](https://www.scq.ubc.ca/boiling-lobsters-and-other-things-people-do/) - Is it OK to boil a lobster? Short answer: Yes, of course it is. Long answer: Let’s consider the life, or rather the death, of a lobster. In nature lobsters begin very small and die a million horrible deaths in a million horrible ways. As they get older the death rate drops. We have ample - [UP OR DOWN? AN EFFICIENCY-BASED ARGUMENT FOR OPTIMAL TOILET SEAT PLACEMENT](https://www.scq.ubc.ca/up-or-down-an-efficiency-based-argument-for-optimal-toilet-seat-placement/) - - - - UP OR DOWN? As long as males and females have been living with indoor plumbing they have argued over the placement of the toilet seat. Most often, males leave the toilet seat up and females leave the toilet seat down. Males may not necessarily have a problem with the toilet seat down, - [WHAT NAGOYA COP10 ISN'T](https://www.scq.ubc.ca/what-nagoya-cop10-isnt/) - A particularly tricky wrestling move. The long anticipated installment of a popular Japanese police TV serial. An unfortunate typo for an especially niched Japanese pop music chart. An ointment used to treat especially aggressive forms of Nagoya. The first line of a haiku that was awarded the distinction of being "most boring." Next year's popular - [IN MEDIA RES: NEWS AND THE PUBLIC (MIS)UNDERSTANDING OF SCIENCE](https://www.scq.ubc.ca/in-media-res-news-and-the-public-misunderstanding-of-science/) - "The best lack all conviction, while the worst ere full of passionate intensity.” The Second Coming, William Butler Yeats - - - “Scientists identify gene that influences quality of person’s empathy”… “Earth ‘heading for 6ºC’ of warming”… “From the lab, a New Weapon Against Cholesterol”. These three headlines were taken from three leading and reputable - [THE MISSING LINK BETWEEN ROCK AND PET ROCK](https://www.scq.ubc.ca/the-missing-link-between-rock-and-pet-rock/) - I’ll begin by apologizing to the media reporters who rushed here thinking they were covering a car accident involving an elderly pedestrian, two kittens, and a baby. To my chagrin, I did not receive any RSVPs to “Shock Rock Talk 2010.” How was I going to know how much sheet cake to order? It’s in - [VENUS AND THE VEGAN](https://www.scq.ubc.ca/venus-and-the-vegan/) - I was a vegan, you know. That was my choice. All the others—well, as soon my siblings wriggled free from the amber chambers of our pupal stage, they began to indulge their taste for the fetid and putrefying. They dove into the waxy mustard lakes of Aunt Peggy's deviled eggs, lapping at stale currents of - [GOODNIGHT LUNA](https://www.scq.ubc.ca/goodnight-luna/) - (With respect to Margaret Wise Brown marvelous words). - - - Goodnight Luna. Goodnight spacecraft orbiting Luna. Goodnight Chang'e, And the Lunokhod rovers. Goodnight norite. Goodnight dunite. Goodnight granophyre, And goodnight vitrophyre. Goodnight olivine, And goodnight pyroxene. Goodnight gabbronorite, And goodnight labradorite. Goodnight orthoclase, And goodnight anorthosite. Goodnight hypersthene, Goodnight troctolite, And goodnight to the - [THE WISHING WELL](https://www.scq.ubc.ca/the-wishing-well/) - Tales of Wonder from the Land of Lab: Fairy Tales and Bedtime Stories for Scientists - - - Once upon a time in a Lab far far away, Princess Jane was a second year graduate student trying to clone a gene from maize. It was a bold and difficult Task set by her Supervisor. Jane - [LIMERICKS TO PONDER](https://www.scq.ubc.ca/limericks-to-ponder/) - Creationist theory is moot. Nature chose an alternative route / root. You've seen Darwin's chart. You know me by heart-- I'm the white guy up front in a suit. Unfounded beliefs and defiance, In obedience more than compliance. Here's hoping (in vain?) That good faith will soon gain A greater alliance with science. AGE-OLD QUESTIONS - [IMPROVING MATERNAL HEALTH IS NOT ROCKET SCIENCE BUT REQUIRES POLITICAL WILL](https://www.scq.ubc.ca/improving-maternal-health-is-not-rocket-science-but-requires-political-will/) - Is it acceptable for mothers to die of preventable causes during pregnancy because they are poor? Sadly, this is the pattern revealed by the United Nations (UN) statistics which show that dying of preventable causes is still a reality for half a million women every year [1]. These women live in the world’s poorest countries - [NEW MICROBIAL CREATIONS](https://www.scq.ubc.ca/new-microbial-creations/) - (Two pieces written on April 26th, 2010. Everyone in the class had a chance to explore the microbial world with microscopes.) - - - "TRY HARD" It was a rainy day at the marsh and a new difflugia microbe just formed. It looked like a piece of candy - the sound it made was a - [IF ONLY MORE PEOPLE WERE LIKE THE CHOWDHURY'S](https://www.scq.ubc.ca/if-only-more-people-were-like-the-chowdhurys/) - Advanced publicity for The World is Round: A Year of Living Off the Land and Off the Grid, by M. Chowdhury The heroic and humorous account of one Bengali family’s year long attempt to go without the fruits of the world economy. After stumbling across a LiveEarth brochure at a local recycled-goods pile, the Chowdhury - [LESSER KNOWN LAWS OF PHYSICS AND MATHEMATICS](https://www.scq.ubc.ca/lesser-known-laws-of-physics-and-mathematics/) - The Einstenian Hillbilly Theory of Marriage: It’s all relative. Fermat’s First Theorem: The one he made in pre-school that showed why bullies are idiots. The High School Uncertainty Principle: You can never simultaneously tell how fast you should be moving in a relationship or at what position you are currently in. Central Limit Theorem as - [SEXTING: THE "PERFECT STORM" OF EVOLUTION, CULTURE, AND TECHNOLOGY (SOME THOUGHTS)](https://www.scq.ubc.ca/sexting-the-perfect-storm-of-evolution-culture-and-technology-some-thoughts/) - The “modern” human is the product of evolution, a natural process that operates on scales ranging from millions, to hundreds-of-thousands, to tens-of-thousands of years. The average individual of today is little changed from the average individual 30,000 years ago. We are literally prehistoric when we are born. Culture, our ability to pass information, artifacts, and - [TYRANNOSAURUS REX JUST WANTS TO BE LOVED](https://www.scq.ubc.ca/tyrannosaurus-rex-just-wants-to-be-loved/) - People look at me, and all they see is the most powerful set of carnivorous jaws in the animal kingdom. But there's more to me than that. I've also got a big heart, a heart that weighs close to two hundred pounds. And it’s broken. Caleb dumped me last week. He said that if I - [HIRING SEVEN NEW FACULTY!](https://www.scq.ubc.ca/hiring-seven-new-faculty/) - (Well, actually 6 since the first ad is not real...) - - - JOB POSTING: "IT'S ONLY A MATTER OF TIME" This is a call for outstanding candidates to apply for a tenure track assistant professor position within the context of the Michael Smith Laboratories at the University of British Columbia. The successful applicant is - [COLLABORATIVE CREATIVITY POEM](https://www.scq.ubc.ca/collaborative-creativity-poem/) - (Written on January 18th, 2010. Everyone in the class defined either "science" or "writing". We then compiled them to define creativity.) - - - Creativity is exploring and discovering things unknown to man, the study of life and the literature of learning, discovering new and old things. It is putting your mind on a piece - [WRITE SOMETHING SCIENCE-Y AND WIN ONE OF TWO IPOD NANOS](https://www.scq.ubc.ca/test/) - - - - Ahhhh... The summer is over, and although we seem to be generally slowing down with age, we still have some gumption in us. Consequently, we feel that it is that time of year to dust off the keyboard, renew our lists, and maybe get down to writing that science masterpiece you've been - [DEEP THOUGHTS OF A ROBOT 2](https://www.scq.ubc.ca/deep-thoughts-of-a-robot-2/) - (Deep Thoughts of a Robot 1 can be found here) - - - - [GENOMIC DNA EXTRACTION IS ABOUT THE PLAYING](https://www.scq.ubc.ca/genomic-dna-extraction-is-about-the-playing/) - We are grand father-grand son duo emotionally intertwined like the two complementary strands of a DNA duplex. Unlike the weak H bonds in the biomolecule, our attachment is due to divine bonds strengthened by a friendship extraordinaire. Farzaan, eight-year old grandson of the senior author, is a regular viewer of ‘Backyard Science’ shows on television. - [DEEP THOUGHTS OF A ROBOT 1](https://www.scq.ubc.ca/deep-thoughts-of-a-robot-1/) - (Introducing a new series by Ralph Gamelli) - - - - [GRAD WARS](https://www.scq.ubc.ca/grad-wars/) - During my commute home a few weeks ago, I came across an old classmate from high school. After our initial exchange of typical greetings, we customarily inquired each other about our current endeavors. I quickly learned that he obtained a Bachelor of Business Administration from Simon Fraser University and is currently working for a small - [INTRODUCING THE SCIENCE SCOUT BADGES FREE MARKET ECONOMY!](https://www.scq.ubc.ca/introducing-the-science-scout-badge-free-market-economy/) - Original article can be found at our Science Scout site. - - - (Acronyms used: SSBFME = Science Scout Badges Free Market Economy) So... It's been a few years since the Science Scouts were born, and (at last count) we have received over 300 emails from various Indian or Chinese Embroidery companies looking to "offer - [OUR DREAM AND OTHER PIECES OF MICROBIAL (VERY SMALL) FICTION](https://www.scq.ubc.ca/our-dream-and-other-pieces-of-microbial-very-small-fiction/) - Part of our Science Creative Literary Symposia. - - - MY DREAM Hi, my name is Difflugia, and I live by the marshes. My dream is to become a world class swimmer in the microbe Summer Olympics. My older brother says I look like a tadpole because of my sleek body. I am superb at - [INTRODUCING THE PHYLOMON PROJECT! KEYWORDS POKEMON AND BIODIVERSITY](https://www.scq.ubc.ca/introducing-the-phylomon-project-keywords-pokemon-and-biodiversity/) - (From http://phylomon.org) (Facebook group: link) - - - “When you have seen one ant, one bird, one tree, you have not seen them all.” ~ E. O. Wilson. Well 2010 is here, a.k.a. the International Year of Biodiversity, and to us at the SCQ, it means that we're finally ready to go ahead with our - [BILLIONS AND BILLIONS](https://www.scq.ubc.ca/billions-and-billions/) - i am just a child. please hold my hands as i wade through these, &, everything. i want carl sagan to help me count the stars, i want to know just what it means that there are billions and billions of these things, & just what is the universe, & when is something called a - [WHEN ROBOTS RISE UP AGAINST US, DO YOU KNOW WHOSE SIDE YOU'LL BE ON?](https://www.scq.ubc.ca/when-robots-rise-up-against-us-do-you-know-whos-side-youll-be-on/) - It’s really very simple: you’ll want to be on the winning side. With that in mind we should look at a few notable factors and choose wisely. First, let’s think about sheer numbers. There are “robots” everywhere. But when the time comes, only anthropomorphic robots will give us any trouble. What’s a sentient printer going - [AFTER COPENHAGEN: I FEAR CORRESPONDENCE OF THIS SORT WAS SENT.](https://www.scq.ubc.ca/after-copenhagen-i-fear-correspondence-of-this-sort-was-sent/) - “In stark contrast to its cuddly international image, Canada is the dirty old man of the climate world – missing its Kyoto emissions reduction target by a country mile (by 2007, it was 34% above its target) and showing no signs of reigning in its profligacy.” The Guardian, November 30, 2009 - - - >Jimbo, - [MY EARTH DAY RESOLUTIONS](https://www.scq.ubc.ca/my-earth-day-resolutions/) - 1. Switch birdfeeders from nuclear to solar. 2. Fill in backyard Superfund pit with cement. 3. Paint cement over Superfund pit green, with cute little flower designs. 4. Adopt one of the polar bears at the zoo (the one that doesn’t look so scraggly). 5. Print out a picture of Al Gore and pin it - [POSSIBLE REASONS I WOKE UP TO FIND I HAD NO LEGS THIS MORNING](https://www.scq.ubc.ca/possible-reasons-i-woke-up-to-find-i-had-no-legs-this-morning/) - Avian leg flu. God is cruel and vengeful and this is how he really spends his Sundays. There is no "God". Nor "legs". Someone I know was jealous of my legs and recently found a lamp containing a genie. The Heisenberg uncertainty principle argues that something that is observed is forever changed by the mere - [ABHORRENT TO NATURE: NOTABLE SCIENTIFIC EXPERIMENTS AND THEIR CONSEQUENCES](https://www.scq.ubc.ca/abhorrent-to-nature-notable-scientific-experiments-and-their-consequences/) - “A pair of otherwise distinguished physicists have suggested that the hypothesized Higgs boson, which physicists hope to produce with the [Large Hadron Collider], might be so abhorrent to nature that its creation would ripple backward through time and stop the collider before it could make one…” (The New York Times) - - - In 2008, - [THE DEFINITION OF SCIENCE AND THE DEFINITION OF WRITING EQUALS THE DEFINITION OF CREATIVITY](https://www.scq.ubc.ca/the-definition-of-science-and-the-definition-of-writing-equals-the-definition-of-creativity/) - Everyone in the class defined either "science" or "writing." We compiled them to define "creativity." - - - Creativity is learning, experimenting, teamwork and interest. It is putting things together to make the unknown, a really cool subject because there is no such thing as bad art. It is the unknown world of living things, - [PROFESSOR J. BLUCHER AND THE PROBLEM OF THE CLASSROOM](https://www.scq.ubc.ca/professor-j-blucher-and-the-problem-of-the-classroom/) - I thought I would share a funny story of what recently happened to a colleague of mine. The fellow in question, Professor J. Blucher, was recently trying to schedule a room for his undergraduate class, Mastering Sextants. This year, the class, which usually numbers only a handful of students, had nearly 150 sign up. Initially - [THE PHYSICAL LAWS (OF THE UNIVERSE) ON TWITTER](https://www.scq.ubc.ca/the-physical-laws-of-the-universe-on-twitter/) - (You too can follow the @physicallaws of the universe). - - - The physical laws of the universe have just started a twitter account. Not surprising, but the 1st law of thermodynamics doesn't think much of unicorns. The physical laws of the universe are at the mall. As usual, Archimedes Principle is hogging the bathroom. - [THE TIME TO SPEAK UP IS NOW](https://www.scq.ubc.ca/the-time-to-speak-up-is-now/) - On Sunday, August 2nd 2008, in Santa Cruz, California, a firebombing destroyed David Feldheim’s car. The smoke from the fire filled the first floor of his house, so he and his wife, along with their 6-year-old daughter and 7-year-old son, had to drop a ladder from the window of a second floor room to escape. - [MY DINNER WITH MIKHAIL BAKHTIN](https://www.scq.ubc.ca/my-dinner-with-mikhail-bakhtin/) - [We see the ‘father-of-global-warming”, James Hansen, walk out of the Goddard Institute for Space Studies in downtown New York City. James has a blank expression. We hear his voice commenting on the action, as the narrator would. This narrating voice will be labeled “JAMES’ NARRATION” to distinguish it from James Hansen’s actual words within the - [WAITING FOR ... THE WORLD (OR THE TROUBLE WITH CONSUMERISM)](https://www.scq.ubc.ca/waiting-for-the-world-or-the-trouble-with-consumerism/) - A One Act Tragicomedy based on the style and characters of Samuel Beckett’s Waiting for Godot - - - A city street in Vancouver. No trees. Dawn. The near future. Vladimir flat on the ground. Sleeping. Estragon standing, teeth clenched, pressing buttons on his flip cell phone. Flips it open, flips it closed, flips it - [WRITE PRIME](https://www.scq.ubc.ca/write-prime/) - 999999999999999999999999999999999999999999999999999999 900000000000000000000000000000000000000000000000000009 900000000000000000000000000000000000000000000000000009 900088000088008888880000888888008888888800888888880009 900088000088008800088800008800000008800000880000000009 900088000088008800088800008800000008800000880000000009 900088000088008800880000008800000008800000888888800009 900088088088008888800000008800000008800000880000000009 900088088088008800880000008800000008800000880000000009 900008800880008800088000008800000008800000880000000009 900008800880008800008800888888000008800000888888880009 900000000000000000000000000000000000000000000000000009 900000000000000000000000000000000000000000000000000009 999999999999999999999999999999999999999999999999999999 *10^375+1 - - - I obtain much pleasure from writing. Also from reading books. Literature is the greatest art form in the world. And so I imagine a writer living in a small efficiency apartment in the southern part of the - [DARWIN'S STRANGE INVERSION OF REASONING (VIDEO)
DANIEL DENNETT
JANUARY 14th, 2009](https://www.scq.ubc.ca/darwins-strange-inversion-of-reasoning-videodaniel-dennettjanuary-14th-2009/) - “Darwin's Strange Inversion of Reasoning” (January 14th, 2009, Frederick Wood Theatre) - - - One of Darwin’s earliest critics noted his “strange inversion of reasoning: in order to make a perfect and beautiful machine it is not requisite to know how to make it.” This is indeed a counterintuitive idea, but it is central not - [STILL LIFE WITH A MODEL ORGANISM](https://www.scq.ubc.ca/still-life-with-a-model-organism/) - - - - Last Thanksgiving, I needed to bring my flies home for the holidays in anticipation of the eclosion of important potential recombinant male progeny. My goal was to use my freezer, a tray of ice, a dissection pad, a paintbrush, and some hoisted fly food vials from my lab to separate the males - [LAW AND ORDER: PARASITIC INTENT. EPISODE 238 - THINGS AREN'T ALWAYS AS THEY NOSEMA](https://www.scq.ubc.ca/law-and-order-parasitic-intent-episode-238-things-arent-always-as-they-nosema/) - This program contains graphic scenes of violence and adult themes. Viewer discretion is advised. - - - THE SCENE Light is pouring into the courtroom. A tense background of hushed conversation fills the room. The defendant, Nosema enters the room. He is a microsporidian parasite. He’s roughly oval shaped and dressed in an orange jumpsuit. - [HOW MANY SPECIES ARE THERE ON EARTH? A FINAL, DEFINITIVE, AND PRECISE ANSWER](https://www.scq.ubc.ca/how-many-species-are-there-on-earth-a-final-definitive-and-precide-answer/) - ABSTRACT There are 42, exactly. - - - Key acronyms: JAL, EO, UW, CSU, MSU, ATBI, INBio, OUTBio, NTFC, and BINGO! INTRODUCTION For what seems to be an interminable period of time biologists have been whining that all of the other sciences know more about their basic inventories than we do. Chemists have filled out - [UNTITLED](https://www.scq.ubc.ca/untitled-4/) - whole green leaves eaten away across an expansive canopy of undergrowth. soft wet soil pulled slowly toward the sea as bits of rocky structure show through and red-brown, mossy trunks cling low & climb high to chase the water and the light. - [INTERESTING AND SOMEWHAT RANDOM ASSORTMENT OF ORGANISMS OR INAPPROPRIATE ANIMAL NAME FOR BROWNIE GIRL GUIDE LEADERS](https://www.scq.ubc.ca/interesting-and-somewhat-random-assortment-of-organisms-or-inappropriate-animal-name-for-brownie-girl-guide-leaders/) - Barricuda Fox Tit Minx Cougar - - - Greetings everyone! Please join us in ushering the International Year of Biodiversity! For those with science and badge affections, this includes a special New Year's resolution whereby an amendment to the Science Scout drinking game rules is hereby now effective. For the year 2010, any mention of - [THIS IS THE TRUTH](https://www.scq.ubc.ca/this-is-the-truth/) - premise | suggest | edits | Wilco Effect - A WEB EXPERIMENT - (In no particular order) 1. Cigarettes are bad for you. 2. Men and Women are equal. 3. Global Warming is real, and (by the way) it's all our fault.* 4. It's not all relative. 5. Gin is better than Whiskey. Whiskey is - [THIS IS THE TRUTH: EDITS](https://www.scq.ubc.ca/this-is-the-truth-edits/) - truth | suggest | premise VERSION 2.0 (21/12/09) (In no particular order) 1. Cigarettes are bad for you. 2. Men and Women are equal. 3. Global Warming is real, and (by the way) it's all our fault.* 4. It's not all relative. 5. Gin is better than Whiskey. Whiskey is better than Gin. 6. Intelligent - [HOW THE PINCH STOLE CHRISTMAS!](https://www.scq.ubc.ca/how-the-pinch-stole-christmas/) - (There are more science Christmas plays by Vince LiCata here, here and here). Cast: Generic Faculty Member Pinch Narrator The Dean The Chair Cindy Lou Who Darth Vader Santa - - - NARRATOR: Every Who Down in U-ville Liked their research a lot… FACULTY: (pipeting): I sure like research a lot. I love running gels, - [HELIUM PILLS FOR REINDEER AND OTHER TRICKS OF THE CHRISTMAS TRADE](https://www.scq.ubc.ca/helium-pills-for-reindeer-and-other-tricks-of-the-christmas-trade/) - Other kids may be convinced that Santa Claus uses some kind of Christmas magic to get the job done. Not my offspring. They have told me that obviously, Santa is putting his trust in science. (And also technology. But the holidays are no time for ugly spats about disciplinary boundaries.) From the younger offspring: Santa - [WHAT IS TWITTER GOOD FOR?](https://www.scq.ubc.ca/what-is-twitter-good-for/) - Well, it's been about three weeks since I signed up for a personal account on twitter (you can follow me here if you're interested - my handle is @dnghub), and threw out my first "tweet." Since then, I've found myself fully immersed in the web tool, and feel like I can say a few intelligent - [EVOLUTIONARY DEAD ENDS: PLANT SPECIES](https://www.scq.ubc.ca/evolutionary-dead-ends-plant-species/) - In an earlier essay, some of the now extinct species of animals were presented. Their characteristics were described as best as the evolutionary biologists can presently determine, and various theories were put forth as to the reasons they became extinct. It is now time to examine some of the plants on which those biologists have - [ON NATUROPATHY, PRESCRIPTION DRUGS, AND THE SANCTITY OF SCIENCE ITSELF](https://www.scq.ubc.ca/on-naturopathy-prescription-drugs-and-the-sanctity-of-science-itself/) - Regarding Bill 179 - whereby graduates of Canada's two naturopathy schools may be given drug prescribing rights by the Ontario legislature. Please read this for further information (Nov 25th, 2009) - - - The science-based community is always at a disadvantage in these sorts of outcries, because we're limited to the evidence, and we can't - [THE DEATH OF A HUMAN HEART AND OTHER ANATOMICAL POEMS](https://www.scq.ubc.ca/the-death-of-a-human-heart-and-other-anatomical-poems/) - Part of our Science Creative Literary Symposia. - - - THE DEATH OF A HUMAN HEART By Emma Sloan A human heart shall surely break, by the time it’s worldly and frail. From an attack, or An enemy’s deathly siege. Or from yearning for the embrace of a loved one long past. But which is - [FREDDY MIND AND YOICHIRO NAMBU: TOGETHER AGAIN](https://www.scq.ubc.ca/freddy-mind-and-yoichiro-nambu-together-again/) - “The Royal Swedish Academy of Sciences has decided to award the Nobel Prize in Physics to Yoichiro Nambu.”—Press Release, the Royal Swedish Academy of Sciences - - - FREDDY MIND: To begin with, let me introduce myself. My name is Freddy Mind. It’s a stage name. I was once one-half of the physics duo of - [A DAILY LOG OF CONCERNS BY A MEMBER OF THE UNION OF CONCERNED SCIENTISTS](https://www.scq.ubc.ca/a-daily-log-of-concerns-by-a-member-of-the-union-of-concerned-scientists/) - Why does my hair keep falling out? Why would it skip going gray and go straight to falling out? What if my lab coat has a stain on it and I just can’t see it? Will people be able to tell this is the same lab coat I wore yesterday? Is it going to rain? - [GENDER QUEST](https://www.scq.ubc.ca/gender-quest/) - (If you want to leave a comment about the talk, please do so here). - - - Topic: Alex discusses the influence of gender in his own life in this TEDx talk, describing both medical and social perspectives of gender in our daily lives and the impact and consequences these perspectives bring to every individual. - [THE BLUE GOLD – HOW MUCH IS IT WORTH TO US?](https://www.scq.ubc.ca/the-blue-gold-–-how-much-is-it-worth-to-us/) - We utilize it for washing and waste disposal, employ it for transportation, power generation and irrigation, use it for cooking and after all need it to live – water. Although it is essential for all life on our planet, we often forget that freshwater resources are limited and in short supply in many regions of - ["V=IR" WEEKEND (WHERE "I" IS IN AMPERES)](https://www.scq.ubc.ca/vir-weekend-where-i-is-in-amperes/) - CD Title: Inverse: (Special limited edition release) (2009) Artist: VAMPIRE WEEKEND Rating: 2.718 stars (out of 5) - - - The rating stands. (Spoiler alert: We rounded.) Actually, we took our cue here from Leonard Euler. Our rating is actually "e," as in the sound of the squeals that will inevitably emanate from the ladies - [PUBLIC HEALTH IN THE 21ST CENTURY: THE OPEN SOURCE OUTBREAK](https://www.scq.ubc.ca/public-health-in-the-21st-century-the-open-source-outbreak/) - (If you want to leave a comment about the talk, please do so here). - - - Topic: Dr. Jennifer Gardy, an alumnus speaker at the event, is co-leading the new genome research lab at the BC Centre for Disease Control (BCCDC). She is also known as Nerd Girl from her Globe and Mail blog - [10 QUESTIONS FOR THE CLONE WHO STOLE MY LIFE](https://www.scq.ubc.ca/10-questions-for-the-clone-who-stole-my-life/) - (See the previous 10 questions piece here) - - - 1. The clone researchers said you were leading a happy life in your cramped, sterile, colorless, soundless storage pod. Why did you feel the need to escape? 2. I doubt any of the idiots at work will notice you're an imposter, but you won't be - [THE RECEPTION TO DARWIN AND THE MYTH OF CREATIONISM](https://www.scq.ubc.ca/the-reception-to-darwin-and-the-myth-of-creationism/) - - - - Presented on March 10th, 2009 at the Second Annual Most Exceptional Escapades in Science (This Time Also Darwinian) High School Student Conference, Michael Smith Laboratories, University of British Columbia. - [PHYLOGENETIC HAIKU BREAK](https://www.scq.ubc.ca/phylogenetic-haiku-break/) - oft called man's best friend canis familiaris asleep on my lap grand white polar bears so sad their numbers dwindle seals would not agree - [EVOLUTIONARY DEAD ENDS](https://www.scq.ubc.ca/evolutionary-dead-ends/) - Man has been studying the fossil records for quite some time now—and we are not referring here to the investigation of old maid Sunday school teachers, Bob Dole, or others long presumed dead—and has discovered that there are many species of plants and animals which have become extinct. While many of these have simply evolved - [UNTITLED](https://www.scq.ubc.ca/untitled-3/) - all the walls are shaking softly & the sharp shining cuts the roof's relief across cracked brickwork to show what went unseen before the light of evening pulls her black shawl over the city night as streetlights flicker & buzz to life, falling west across the breadth of habitation, right to left. the sunlight shakes - [WHAT COLOUR IS A UNICORN?](https://www.scq.ubc.ca/what-colour-is-a-unicorn/) - What color is a unicorn? Well, let’s think about this for a second. There are paintings of unicorns. And there are movies about them. Also unicorns have shown up on tapestries, in novels, poems, songs, video games, tattoos, little sculptures made of plastic that children play with, etc. In fact there are many, many depictions - [DOES THE NAME DR. KRISANA KRAISINTU RING A BELL?](https://www.scq.ubc.ca/does-the-name-dr-krisana-kraisintu-ring-a-bell/) - A review of Cocktail: A Play about the Life and HIV Drug Development Work of Dr. Krisana Kraisintu by Vince LiCata and Ping Chong Truth be told, I don't read plays very often, if at all. In fact, I'm ashamed to admit that I think the last one I read was back in high school - [IMAGINED TALKS WE'D BE CURIOUS TO SEE (A VIDEO)](https://www.scq.ubc.ca/imagined-talks-wed-be-curious-to-see-a-video/) - For more information about TEDxTerrytalks 2009, please click here. - [MY MASSIVE ROBOTIC NASA ARM](https://www.scq.ubc.ca/my-massive-robotic-nasa-arm-5/) - (Because it's also the International Year of Astronomy, over the next few weeks, we are happy to present a few reprinted funny pieces that relate to this business of space - Enjoy!) 1 Went to the mall today. Bought some boxer briefs and an Icee. Stopped into the arcade and lost to some punk kid - [UNFORTUNATE CHAIN OF EVENTS LEADING UP TO PLUTO'S LOSS OF PLANETHOOD](https://www.scq.ubc.ca/unfortunate-chain-of-events-leading-up-to-plutos-loss-of-planethood-2/) - (Because it’s also the International Year of Astronomy, over the next few weeks, we are happy to present a few reprinted funny pieces that relate to this business of space - Enjoy!) Pluto loses car keys Pluto steps in dog crap Pluto's July horoscope warns of "personal challenges ahead" Pluto's rent check bounces Pluto's Mustang - [DALE PECK REVIEWS EINSTEIN'S LATEST](https://www.scq.ubc.ca/dale-peck-reviews-einsteins-latest-2/) - (Because it’s also the International Year of Astronomy, over the next few weeks, we are happy to present a few reprinted funny pieces that relate to this business of space - Enjoy!) Pedestrian crap. Albert Einstein's "General Theory of Relativity" (Annalen der Physik, Leipzig: Verlan Von Johann Ambrosius Barth, 1916) is crap. It's oblique, it's - [DEATH FROM ABOVE: THE TORINO SCALE AND YOU](https://www.scq.ubc.ca/death-from-above-the-torino-scale-and-you-2/) - (Because it’s also the International Year of Astronomy, over the next few weeks, we are happy to present a few reprinted funny pieces that relate to this business of space - Enjoy!) Are you doomed? There's only one way to find out, and that's to consult a colour-coded chart. Take, for example, the Torino Scale, - [HOW I GOT OUT OF WRITING AN ESSAY ON H.G. WELL'S THE TIME MACHINE.](https://www.scq.ubc.ca/how-i-got-out-of-writing-an-essay-on-hg-wells-the-time-machine-6/) - (Because it’s also the International Year of Astronomy, over the next few weeks, we are happy to present a few reprinted funny pieces that relate to this business of space - Enjoy!) January 17, 2005 I received the syllabus for my Humanities course. A humanities course should not be required for my B.Sc degree in - [A WHITE BLOOD CELL NAMED BOBBY DUVAL...](https://www.scq.ubc.ca/a-white-blood-cell-named-bobby-duval/) - This collective story beginning was written during a weeklong science and creative writing camp at the University of British Columbia. For more of the students' work, please click here. To read their endings do click here and scroll down a bit. - - - Once there was a white blood cell, a special white blood - [2/4 OF ONE, 1/2 OF THE OTHER](https://www.scq.ubc.ca/24-of-one-12-of-the-other/) - “Do you believe that black students are less intelligent than white students because their parents do not care about them? Raise your hand if you believe this.” I was able to hold back the tears when my fourth grade teacher asked this question. My best friend and first real crush raised his hand with rest - [A SOCIAL IMPOSSIBILITY THEOREM](https://www.scq.ubc.ca/a-social-impossibility-theorem/) - For centuries, generations of philosophers and social scientists have studied the sources of income inequality in human society. Finally, a major breakthrough in the form of a mathematical proof of a fundamental truth, long suspected by millions of laboring individuals, and now shown rigorously. Theorem: It is impossible for engineers, scientists and the professoriate to - [CARTESIAN DIVERS](https://www.scq.ubc.ca/cartesian-divers/) - This poem was written during a weeklong science and creative writing camp at the University of British Columbia. For more of the students' work, please click here. - - - I am in a science lab. It is filled with machines. My diver is just standing still in the water. She doesn’t want to wreck - [HOW TO BREW BEER IN A COFFEE MAKER, USING ONLY MATERIALS COMMONLY FOUND ON A MODESTLY SIZED OCEANOGRAPHIC RESEARCH VESSEL](https://www.scq.ubc.ca/how-to-brew-beer-in-a-coffee-maker-using-only-materials-commonly-found-on-a-modestly-sized-oceanographic-research-vessel/) - INTRODUCTION Beer brewing is as much an art as a science. Finding the right blend of delicate grains, hops, malt, adding just the right flavoring agents, boiling for exactly enough time to release the tannins, starches, humic acids from you wort, these are all skills that take a lifetime to master. Perfect beer is meticulously - [CICATRIX](https://www.scq.ubc.ca/cicatrix/) - When I would see her thin chart full of medical fluff perched upon the door I'd take a deep breath and relax before heading in. Hers were easy visits. Colds, allergies, acne. Sometimes we'd end her appointment talking about her college. Had she picked a major yet? Did she lead the soccer team in goals - [MY TEAM FOR THE RETURN TO THE MOON](https://www.scq.ubc.ca/my-team-for-the-return-to-the-moon/) - Commemorating the 40th anniversary of the Apollo 11 landing - - - I have assembled my core team members for the return to, and primary colonization of the Moon. I believe that the multi-disciplinary nature of the core team will afford the highest chances of lunar survival. Both human and engineering challenges have factored into - [A GIFT FORGOTTEN (TWISTED HAIKU)](https://www.scq.ubc.ca/a-gift-forgotten-twisted-haiku/) - Puppy in closet - Birthday present for Tommy! Now, nothing but bones. - [THE ELEVATION OF MAN](https://www.scq.ubc.ca/the-elevation-of-man/) - The tour guide stood at the base of the structure and waited for people to catch up and shut up. This was a twice a day activity and it was hot. The structure was a tower 100 stories tall built more than a thousand years ago by an unknown civilization in the heart of the - [MY GREATEST FEAR REGARDING SCIENCE](https://www.scq.ubc.ca/my-greatest-fear-regarding-science/) - [THE DOT SONG](https://www.scq.ubc.ca/the-dot-song/) - A curve is a dot that flew like a hawki. An icosahedron is a dot that didn't know where to stopii. A scribble is a dot not knowing what it soughtiii. A circle is a dot that just goes round and round, A coil is a dot that keeps getting woundiv. An exclamation is a - [GLOBAL ISSUES FOR BREAKFAST: THE BANANA INDUSTRY AND ITS PROBLEMS FAQ (COHEN MIX) ](https://www.scq.ubc.ca/global-issues-for-breakfast-the-banana-industry-and-its-problems-faq-cohen-mix/) - Bananas are just a fruit, how are they considered a global issue? Although bananas may only look like a fruit, they represent a wide variety of environmental, economic, social, and political problems. The banana trade symbolizes economic imperialism, injustices in the global trade market, and the globalization of the agricultural economy [1]. Bananas are also - [REVIEW OF EZRA POUND'S "ON BIOCHEMISTRY" TEXTBOOK, 6TH EDITION](https://www.scq.ubc.ca/review-of-ezra-pounds-on-biochemistry-textbook-6th-edition/) - The long awaited and multiply postponed 6th Edition of Ezra Pound's "On Biochemistry" continues the tradition of the previous five editions by costing far more than one would reasonably imagine such a book should cost. This is the fourth edition of the text published since Pound's death, and thus also continues the biochemistry publishing industry's - [THE UNSENT FINAL COMMUNICATION FROM THE DESK OF ALBERT EINSTEIN](https://www.scq.ubc.ca/the-unsent-final-communication-from-the-desk-of-albert-einstein/) - To Whom I Have Chosen: If you have received this letter, I have met my untimely death. Please know that I have not died by whatever reason(s) was/were publicly given, but was assassinated by extremist religious groups. My battle with them has raged for decades and I have made preparations, knowing this to be my - [WORLD TRAVEL](https://www.scq.ubc.ca/world-travel/) - It is one of those forests where, if you run fast enough, barefooted and alive, you can touch off – roots and ground- shadows become branches, green acorns, and shade falling asleep until you find yourself swimming in the clouds, not kicking but push-gliding, lungs and down-soft sun breathing in and out through every pore. - [MOONRISE](https://www.scq.ubc.ca/moonrise/) - I never realized the moonrise was so bloody. It hangs over the hazy lights of the city like an attacking alien planet, looking much more like Mars than Mars, which actually looks like a star, and is only slightly red if you squint really, really hard. Outside the city, on an empty access road, I - [GENESIS OF EVOLUTION](https://www.scq.ubc.ca/genesis-of-evolution/) - Adam and Eve, naked and not smart, sat somewhere in the Garden of Eden. A snake slithered afoot. It said, "Tss, come gorge yourselves upon the forbidden fruit and escape from your self-incarceration in the prison of ignorance." Adam and Eve looked at each other, shrugged, and started having sex. The snake shook its head - [PARENTS AS A NARCOTIC](https://www.scq.ubc.ca/parents-as-a-narcotic-3/) - Last weekend, Candace, Will and I visited my mother. And, while I was there, I realized I was very tired. Granted, I had not slept well the night before, but it suddenly occurred to me that I am often tired when I visit my mother. Then, on the way home, it also occurred to me - [SUPERPOSITION](https://www.scq.ubc.ca/superposition-2/) - Erwin loved the cat that Niels had given him. Such a lovely cat. He would play records for his cat while he thought and studied deep into the night, and his cat would gently rub against his leg. • When Orpheus laid his eyes upon Eurydice, all else fell away. Though the nuptials were doomed, - [JOKES WITHOUT PUNCHLINES TAKEN FROM A CELLULAR BIOLOGY LABORATORY](https://www.scq.ubc.ca/jokes-without-punchlines-taken-from-a-cellular-biology-laboratory-3/) - 1. A chemical microbiologist, a pathologist and a clown are flying in a small commuter plane between Kansas City and Omaha. Halfway there, the plane bursts into flames and the pilot bails out. The passengers discover there are only two parachutes. Which one dies? 2. 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-3,5-pyridinedicarboxylic acid dimethyl ester walks into a bar. On the - [SIX STORIES](https://www.scq.ubc.ca/six-stories-2/) - For all the movement it was making, it was very silent. For all the movement around it, it was still very silent. At six stories tall, it was, like most New Yorkers, very slender. No longer green, one immediately knows this one has been around the block for many years. When my mother met my - [WHAT'S NEW IN SCANTRON TECHNOLOGIES](https://www.scq.ubc.ca/whats-new-in-scantron-technologies-3/) - The Scantron 8950 (A.K.A. “Lil’ Helper”). Attention, teachers! How many times have you arrived at the scantron machine with your stack of answer sheets and realized that you forgot to fill out the answer key? And where is your pencil? Hang on, because help is on the way. The 8900 may not help you remember - [SHAFTED AGAIN BY NOBEL](https://www.scq.ubc.ca/shafted-again-by-nobel-4/) - I didn't win the Nobel Prize in Physics again this year. What's a guy got to do to win that thing? I was made to win that prize, but for like the umpteenth time in a row I've been given the shaft. Annoying! Who cares if I'm not a physixcist or however you spell it? - [WHITE COAT, WRONG TIME](https://www.scq.ubc.ca/white-coat-wrong-time-3/) - Imagine you’re at Starbucks. You’re halfway through a co-worker’s order (“half sweet, no foam, saffron-scented, opium-spritzed, …”) when two men wearing coveralls come in. You hear them talking about a car they’re fixing. Their garb has grease on it, various stains of indeterminate origin. They saunter up to the till, place their orders, and get - [MOTHER GOOSE AND THE SCIENTIFIC PEER REVIEW PROCESS.](https://www.scq.ubc.ca/mother-goose-and-the-scientific-peer-review-process-3/) - Jack and Jill went up the hill. To fetch a pail of water. Jack fell down and broke his crown. And Jill came tumbling after. First of all, we are not sure there’s enough clarity in this text. Scientific literature, in particular, should leave little room for confusion. Where exactly did Jack fall down? Into - [TO TEACH THE CALCULUS, A PLAY](https://www.scq.ubc.ca/to-teach-the-calculus-a-play-3/) - The recent popularity of math and science based plays and movies, such as "Proof", "A Beautiful Mind", and "Copenhagen", has catalyzed the recovery of lost plays from famous mathematicians and scientists themselves. Below is the complete text of "To Teach the Calculus," which was recently "recovered" from the notebooks of Max Planck. After winning his - [ON KINGDOMS AND THE GALAPAGOS ISLANDS: A TREATISE ON DARWIN’S CONTRIBUTIONS TO MODERN ECOLOGY AND EVOLUTION IN CAKE FORM](https://www.scq.ubc.ca/on-kingdoms-and-the-galapagos-islands-a-treatise-on-darwin’s-contributions-to-modern-ecology-and-evolution-in-cake-form/) - ABSTRACT We present a cake with layers representing the five Kingdoms according to Whittaker (1969; Animalia, Plantae, Fungi, Protista, and Monera; Figure 1). The cake is shaped as a pyramid embodying the dynamic and complex trophic interactions within ecosystems and also symbolizing to the volcanic Galapagos Islands where Darwin travelled and developed his evolutionary and - [THE FUTURE OF CANADIAN MEDICAL CARE IN 2050](https://www.scq.ubc.ca/the-future-of-canadian-medical-care-in-2050/) - The following passage describes a hypothetical transcript of a conversation in the year 2050. This is between a patient Dr Jones (a retired doctor) and his grandson Care Consultant Jones, a doctor of the future. It outlines several possible changes that could take place in Canadian medical care in the next 40 years. Care Consultant - [ON SYMMETRY (AND ITS DESIRABLE, POSSIBLE, AND ACTUAL CONSEQUENCES WITH RESPECT TO THEOLOGY, PARTICLE PHYSICS, AND INTERNATIONAL DEVELOPMENT)](https://www.scq.ubc.ca/on-symmetry-and-its-desirable-possible-and-actual-consequences-with-respect-to-theology-particle-physics-and-international-development/) - I've been thinking lately about the prevalence of symmetry in so many philosophies, ideologies, and such. It seems like just about every major world religion, if not every major religion, has some concept of good versus evil; light versus dark -- dancing an endless waltz; a delicate, fragile deadlock, which, despite all odds, never loses - [A BLUNDER OF MAN](https://www.scq.ubc.ca/a-blunder-of-man-2/) - Help wanted- Vigilant and patient people wanted for an extremely tedious job over about six months. The job involves repetitive work and some lifting. Experience using scanner equipment would be advantageous. Commitment to literature and science essential. Good pay for the right people. Apply Monday, September 6, at the Personnel office, sixth floor of the - [RANK: ANIMAL ILLNESSES](https://www.scq.ubc.ca/rank-animal-illnesses-3/) - Chicken Pox This is the Frank Sinatra of animal-themed sicknesses. A timeless classic, although the younger generations might not appreciate it. I remember fondly going to a Fourth of July Parade as a child, just recovering from the pox, and my mom not letting me look around too much lest other parents see my pox - [SUGAR AND DEMONS: A SCIENTIST'S FIELD NOTES](https://www.scq.ubc.ca/sugar-and-demons-a-scientists-field-notes-3/) - Day 1: While changing my thirteen month old son's diaper, he begins to spin around and around on the bed at an extremely fast pace and giggles loudly to himself, like a madman. This is not his usual behavior. I decide to investigate. Day 2: After spending all night breaking down the circumstances that led - [POLIO: A VIRUS' STRUGGLE](https://www.scq.ubc.ca/polio-a-virus-struggle-4/) - Download the pdf (14pages, ~2.7Mb) (Originally published on October 24th, 2005) - [DARWIN: BEWARE OF JUMPING THE SHARK](https://www.scq.ubc.ca/darwin-beware-of-jumping-the-shark/) - In case, you weren’t yet aware, you’re currently caught in a year for scientific giddiness. A year where a collective hurrah can be heard from those who make it their business to hypothesize, analyze, and formulize. 2009 is the year of Darwin. It’s a double whammy - his 200th birthday, and also the 150th anniversary - [AGING AND CALORIC RESTRICTION: A BRIEF INTRODUCTION](https://www.scq.ubc.ca/aging-and-caloric-restriction-a-brief-introduction/) - Aging and death are prominent sources of concern for individuals of North America (Neimeyer 2004). It is not surprising that longevity and immortality have pervaded almost every culture at some point in time. The ancient Egyptians believed that preserving the body of the deceased would lead to preservation of the physical form in an after-life. - [A VISIT WITH MR. DARWIN](https://www.scq.ubc.ca/a-visit-with-mr-darwin/) - - - - Presented on March 10th, 2009 at the Second Annual Most Exceptional Escapades in Science (This Time Also Darwinian) High School Student Conference - Mr Charles Darwin as interpreted by Dr. Greg Bole of the Zoology Department, University of British Columbia. - [JUST HOW INTO YOU HE IS, IF HE IS A DEER TICK](https://www.scq.ubc.ca/just-how-into-you-he-is-if-he-is-a-deer-tick/) - Stratum Corneum Epidermis Dermis Sebaceous Gland Papilla Bulb Subcutaneous Layer As a friend - [PHOTO OF A NICE SET OF BOOBIES WE SAW AT THE MUSEUM OF NATURAL HISTORY](https://www.scq.ubc.ca/photo-of-a-nice-set-of-boobies-we-saw-at-the-museum-of-natural-history-3/) - (Originally published on April 11th, 2005) - [THE BESTEST, MOST KICK ASS, HUMAN GENOME PROJECT](https://www.scq.ubc.ca/the-bestest-most-kick-ass-human-genome-project-3/) - Mondo-Genetic-Services is proud to announce its latest venture, “The Bestest, Most Kick Ass, Human Genome Project.” Hot on the tails of the International Human Genome Sequencing Consortium and Celera Genomics, we present to you a novel approach in the elucidation of mankind’s blueprint of life. Rather than using the frequently studied yet boring human cell - [WHITE SILKEN RIBBONS](https://www.scq.ubc.ca/white-silken-ribbons-2/) - “And your mother, how is her health?” I asked the cheerful young woman who had come in for a physical examination. She was draped in a blue paper gown under which her naked alabaster skin seemed translucent. Her branching veins coursed like roots close to the surface as they returned indigo blood to the warmth - [5 HOT SCIENCE-Y GUYS](https://www.scq.ubc.ca/5-hot-science-y-guys-3/) - 1. Sir Martin Rees I don’t know if this guy’s straight or gay, and I don’t care. He’s got a certain polished appeal going on, and he’s the freaking Astronomer Royal for crying out loud. What does that mean, you ask? How does that make him any more special than any other astronomer besides the - [EINSTEIN AT PRINCETON](https://www.scq.ubc.ca/einstein-at-princeton-2/) - Einstein sits and thinks under the dark trees surrounding a white cottage — where no war came, even during the years when young men flooded out from this campus, cold from tap like the beer they’d drunk at the Tiger- town Inn just before their first induction. He stirs, but no amount of induction can - [LIMERICKS OF EVOLUTION](https://www.scq.ubc.ca/limericks-of-evolution-3/) - There once was a young man named Darwin Who spent five years tossed to the far wind He wrote a book for his peers After only twenty short years And now he's as pop as George Carlin. They say we all came from a monkey But I say that theory is bunky Because as anyone - [ACCELERATION DUE TO GRAVITY: SUPER MARIO BROTHERS](https://www.scq.ubc.ca/acceleration-due-to-gravity-super-mario-brothers/) - Abstract The purpose of this analysis is to determine the evolution of gravity in the Mario video game series as video game hardware increases. Introduction Gravity is force which is responsible for keeping us on the ground. It is also the force that prohibits us from jumping 50 feet in the air. However, in Mario's - [MANBEARPIG WITH A DAFFODIL](https://www.scq.ubc.ca/manbearpig-with-a-daffodil/) - This poem was composed as a collective where each student was allowed to write a single sentence. The ManBearPig and daffofil topics came up during the symposia session when experiments on molecular chemistry (with specific reference to things like DNA) were performed. - - - Grasping the flower gently, He is ½ man, ½ bear, - [TERRY TALKS VIDEO: TIFFANY TONG - REDEFINING BOUNDARIES, URBAN AGRICULTURE](https://www.scq.ubc.ca/terry-talks-video-tiffany-tong-redefining-boundaries-urban-agriculture/) - (From Terry talks, November 22, 2008) How often do we connect the words “urban” and “agriculture” in our brains? The word “urban” conjures up a concrete jungle where skyscrapers dominate the grey sky. The word “agriculture” makes me see rows after rows and fields after fields of green crops and livestock dotting the landscape. These - [PERSONAL BIOGENETIC ANALYSIS: PROSPECTUS](https://www.scq.ubc.ca/personal-biogenetic-analysis-prospectus/) - I want to be racially profiled, But not by a cop at a stop. I want to find out, By the hair in my snout, What my parent's parent's parents Were all about. I'd like to take the yarn of my DNA And compare it to the yarn they've been spinning – Aunt Millie says - [WHAT IS THE POINT OF SCIENCE EDUCATION?](https://www.scq.ubc.ca/what-is-the-point-of-science-education/) - Recently I have found myself in the unintentional, and unenviable, position of final stumbling block to a young lad's high school graduation. It seems he's been managing to meet all the minimal requirements for a high school diploma, save one: a grade 10 general science credit. After three years and as many attempts, he is - [ORDER OF THE SCIENCE SCOUTS OF EXEMPLARY REPUTE AND ABOVE AVERAGE PHYSIQUE](https://www.scq.ubc.ca/order-of-the-science-scouts-of-exemplary-repute-and-above-average-physique/) - anthem | topics | facebook | twitter * * * For the propagation of an ideal where science communicators can meet firstly, for drinks; secondly, for communicating; and ultimately, for networking. Joining is easy - please simply provide name with your city and a corresponding link (or more - we can take up to 3). - [HOW I GOT OUT OF WRITING AN ESSAY ON H.G. WELL'S THE TIME MACHINE.](https://www.scq.ubc.ca/how-i-got-out-of-writing-an-essay-on-hg-wells-the-time-machine-5/) - January 17, 2005 I received the syllabus for my Humanities course. A humanities course should not be required for my B.Sc degree in Physics. To add insult to injury, we are supposed to do an analysis of Well’s The Time Machine. We are to focus on the historical context when the topic is time travel? - [A COLLECTION OF POEMS](https://www.scq.ubc.ca/a-collection-of-poems-2/) - Untitled (ice cap) If you went to a polar ice cap as an explorer or whatever and found a woman encased in ice looking up, mouth open, yellow robe maybe she even has a shield would you, tired and itchy, think of her as an Ideal, fall to fighting your companions to the death over - [ON STRING THEORY](https://www.scq.ubc.ca/on-string-theory-2/) - My coworker helped her grandmother move out of her home recently. She was 94, she'd broken her hip and now had to move from a small house in the mountains to a residential care facility in the city. The whole family helped pack up her things and prepare the house to be rented. Like almost - [TRASH TALKIN' AT THE AQUARIUM](https://www.scq.ubc.ca/trash-talkin-at-the-aquarium-3/) - Wut up, tortoise? You think you're all that 'cause you can swim really well and stuff? Well, sorry to disappoint you, son, but I can swim really well, too. Sucka. I need to wear water wings, on account I'm scared of deep water, but that's still swimming. So bite me, fool. Ooo, shark, what big - [A COUPLE OF EVOLUTION/BIOLOGY-RELATED HAIKUS](https://www.scq.ubc.ca/a-couple-of-evolutionbiology-related-haikus/) - I had no idea Wikipedia reveals strange platypus truth. It is venemous Charles throws up his hands This freak of nature gave Darwin conniption fits. Sighs. "Oh for fuck's sake." - [LEAKED DEPARTMENT OF INTERIOR MEMO THAT REMOVES AMERICAN SCIENTIST FROM ENDANGERED SPECIES LIST](https://www.scq.ubc.ca/leaked-department-of-interior-memo-that-removes-american-scientist-from-endangered-species-list/) - Department of the Interior Internal Report (Committee Level) Date: Feb. 16, 2009 Subject: Determination of Endangered/Threatened Status Species: The American Scientist (Homo Scientius Americanus) Recommendation: Upgrade from Endangered to Threatened Background/History: For the past eight years, the noble American Scientist has teetered on the brink of total extinction. Over-hunted by religious groups and faced with - [EVOLUTION AND THE INDIVIDUAL TALENT](https://www.scq.ubc.ca/evolution-and-the-individual-talent/) - “Hiccups, hernias and hemorrhoids are all caused by an imperfect transfer of anatomical technology from our fish ancestors.”--biology professor Marlene Zuk in The New York Times (1/20/09) Don’t let’s go there. We all have our instinctual phobias and obsessions, a fear of sharp-beaked shadows, or a scarcely controllable urge to upgrade that in-home lap pool, - [TERRY TALKS VIDEO: MIKE GRETES - MAKING MEDICINES FOR PEOPLE, NOT FOR PROFIT](https://www.scq.ubc.ca/terry-talks-video-mike-gretes-making-medicines-for-people-not-for-profit/) - (From Terry talks, November 22, 2008) . All lives, no matter where they are lived, have equal value. Yet access to life-saving drugs is most often limited to those who can pay for them. Also, treatments for many tropical diseases are either unavailable or are increasingly ineffective, with toxic side effects to boot. Universities Allied - [STEM CELL RESEARCH (AS IMAGINED BY ITS OPPONENTS)](https://www.scq.ubc.ca/stem-cell-research-as-imagined-by-its-opponents/) - I. THE HEADQUARTERS OF SCIENCE (EUROPE) - Hand me the abortion elixir. - But – but Master, it has yet to finish bubbling. - What in the Darwin?! Here, hold another burning Bible below it. It usually takes three or four. - But why can't we use these perfectly suitable adult stem cells? I have - [YOU MAKE ME SICK: DOES MALADAPTIVE PSYCHOLOGY CAUSE AUTOIMMUNITY](https://www.scq.ubc.ca/you-make-me-sick-does-maladaptive-psychology-cause-autoimmunity/) - One of the most prominent environmental risk factors described for numerous diseases is chronic exposure to stressful situations. – "Chronic stress and individual vulnerability," Schmidt MV, Sterlemann V, Müller MB, Annals of the New York Academy of Sciences, December 2008, 1148, 174-183. Is it really true that autoimmune diseases become more active in response to - [A CREATIONIST FAQ](https://www.scq.ubc.ca/a-creationist-faq-3/) - Q: What is the principle evidence for Creationism? A: The Holy Bible, of course. After all, is it likely that the author of the Universe would be mistaken about its age? Q: But isn't the Bible religion and not science? A: Truth is truth. It's a poor sort of science that ignores truth. Q: But - [OPEN LETTER TO THE KANSAS SCHOOL BOARD.](https://www.scq.ubc.ca/open-letter-to-the-kansas-school-board-3/) - I am writing you with much concern after I read of your hearing to decide whether the alternative theory of Intelligent Design to be taught along with the theory of Evolution. I think we can all agree that it is important for students to hear multiple viewpoints so they can choose for themselves the theory - [A MISPLACED CHAPTER FROM THE BOOK OF GENESIS](https://www.scq.ubc.ca/a-misplaced-chapter-from-the-book-of-genesis-4/) - And lo, it came to be that God was sitting around in his Lazy-God recliner one quiet millennium, and He sayeth unto His Godlike self: "God is bored and needs some entertainment." And lo, God created the Earth and all it's inhabitants without getting up from the Lazy-God chair, even whence God needed the occasional - [DESCENT OF DOG](https://www.scq.ubc.ca/descent-of-dog-2/) - Samson shivered in the early morning chill, jingling the chain joining his collar and leash. The sun was a big orange food bowl hanging low on the horizon, bathing the neighborhood in its warm glow. Most of the residents were still in bed at this hour, but a few dotted the sidewalks with their best - [LIMULUS & CHARLIE](https://www.scq.ubc.ca/limulus-charlie-4/) - Charlie wears broken glasses held together with tape and toothpicks. He is unemployed and occupies a one-bedroom apartment in Westchester, California, a half-mile northeast of LAX. Charlie eats in his car. His 1991 Nissan Stanza is a mausoleum of fast food, Frito Lay and Little Debbie wrappers. When Charlie was in the sixth grade, some - [I.D. ON THE STAND](https://www.scq.ubc.ca/id-on-the-stand-2/) - A retelling of Kitzmiller vs. Dover Area School District,with apologies to Ernest L. Thayer The outlook wasn't brilliant 'neath that Pennsylvania sky: The courts stood N to zip before the new case here to try. Creationism in the schools had died a legal death, And now as Rothschild rose, Gishville IDers held their breath. The - [THE HMS BEAGLE PROJECT - A SCIENCE CREATIVE QUARTERLY PIN UP (NO. 3)](https://www.scq.ubc.ca/the-hms-beagle-project-a-science-creative-quarterly-pin-up-no-3-2/) - (CLICK HERE FOR PIN-UP POSTER - pdf file ~200k) – We suggest photocopying at 129% - LTR to 11×17 – My wish was to be buried in the Churchyard at Downe. Now I find Mr Huxley, thumbing his nose at the Queen for refusing me a knighthood, arranged to have me planted in that mausoleum - [OF EVOLUTION AND THE BIBLE](https://www.scq.ubc.ca/of-evolution-and-the-bible-2/) - In the Beginning… Many people believe that there is a conflict between science and religion when it comes to the question of how life began on Earth. While only a minority of people situate themselves squarely on one side of this debate, the topic tends to draw the attention of everyone. This is because the - [LOTIC](https://www.scq.ubc.ca/lotic-2/) - In electric confrontations, the clouds gather, grow dark, and grumble their dissent. They lumber about like gravid beasts, heavy bellies aimed at the earth below; a slow dance that lasts for days. Then, like a crescendo, it rains. Not an unusual phenomenon in this urban area of the west coast trapped between the mountains and - [IN WHICH OUR PROTAGONIST LEARNS THE IMPORTANCE OF THE BASE CASE](https://www.scq.ubc.ca/in-which-our-protagonist-learns-the-importance-of-the-base-case-2/) - I was three years old. By this point in my life, the residents of Sesame Street had educated me about as well as any community of puppets could reasonably be expected to educate any small child. Family legend has my father holding me, age fifteen months, as he selected an ice cream treat from the - [THE SCIENCE/ARTS DIVIDE STANDS BETWEEN US: A LOVE STORY](https://www.scq.ubc.ca/the-sciencearts-divide-stands-between-us-a-love-story/) - “Tell me something interesting,” he says to me as we sit side by side on the bus. He looks so cold and calculated and I wonder if he feels anything towards me at all. He takes up room in his seat. I barely fit next to him. He is an overachiever, overeducated and impeccably self-reliant, - [PRE-MED STUDENT ACCIDENTALLY CURES CANCER](https://www.scq.ubc.ca/pre-med-student-accidently-cures-cancer/) - Patrick McCarthy, a pre-medical student, who previously referred to his general chemistry lab requirement as "the dumbest thing [he's] ever heard of," has discovered the cure for cancer, Nature News reports. McCarthy, 22, discovered a special class of polyphenolics during last Monday's extraction of the compounds from apples, says John Strova, a sixth-year graduate teaching - [THE LABORATORY CALLED LIFE](https://www.scq.ubc.ca/the-laboratory-called-life/) - The study of cognition and theory of mind is an emerging field of science that receives its inputs from psychology, neuroscience and behavioural biology. Children are known to develop a theory of mind around the age of three to four years, and many experiments have been conducted to test this development in young children, and - [THE CHIMERA FILES: WHEN DOGGIE MET KITTY (PUN HEAVY VERSION)](https://www.scq.ubc.ca/the-chimera-files-when-doggie-met-kitty-pun-heavy-version/) - "Woman Claims Puppies Were Born To Cat; Says Neighborhood Mutt Impregnated Feline"-Reuters Doggy: Before Ms. Pretty Kitty? I ran with a tough pack of stray dogs. I was always out chasing tail—usually my own. Kitty: In my strict Siamese family, we were discouraged from dating outside the breed—never mind outside the species! Doggy: When I - [PHRASES WHICH SOUND PLEASANT ENOUGH BUT ARE ACTUALLY KIND OF SCARY](https://www.scq.ubc.ca/phrases-which-sound-pleasant-enough-but-should-actually-scare-the-shit-out-of-you/) - Cruises in Iran Hummer coming through Intelligent design in the school Global Warming - [SNOOZE OR LOSE](https://www.scq.ubc.ca/snooze-or-lose/) - Here we go again. In order to finish my term paper on time, I must pull an “all-nighter”. It is a tactic I employ increasingly often despite knowing the consequences: I will be a zombie the next day, with my eyes drooping and my head embarrassingly bobbing as I ride the bus or ‘attend’ Powerpoint - [EXCERPTS FROM A COLLECTION OF MICROBIAL RENGAS](https://www.scq.ubc.ca/excerpts-from-a-collection-of-microbial-rengas/) - My ideal microbe has sharp teeth, fury and green. It eats my homework. It likes math homework the best, but it will eat anything. My ideal microbe absolutely hates the sun, drinks ocean water. He smells like sour lemonade, but he doesn’t like lemons. Jonathan Chan and Carl Laurente David Lloyd George Elementary - - - [The Terry Talks YouTube experiment.](https://www.scq.ubc.ca/the-terry-talks-youtube-experiment/) - For those of you at this year's Terry talks, you'll obviously be aware of our little YouTube experiment. In any event, I present to you the fruit of that labour below. If you weren't at the conference, here is the gist: audience members were ask to participate by brainstorming, pitching, choosing, and then executing an - [LITTLE ASSISTANT PROFESSOR ANNIE](https://www.scq.ubc.ca/little-assistant-professor-annie/) - A Christmas Play Characters: Interim Chairman Hannigan: runs the department with an iron fist Assistant Professor Annie Assistant Professor Molly Assistant Professor Pepper Assistant Professor Derek Assistant Professor Oliver Twist Sandy, a graduate student Dean Grantbucks Dr. Farrell, Daddy Grantbucks’ Assistant Dean Note: Except when they are singing (in synchrony) or when they say “Yes, - [WARM TIDINGS](https://www.scq.ubc.ca/warm-tidings/) - Virginia, will you ask again this year Whether melting ice-caps scare his deer? Ice-water never was so warm As amid the mighty powers' swarm. But children in Russia and Timbuktu Will get their Christmas presents, too; And sweet lead paint will not compete With family, good cheer, and meat; And submerged futures and frozen hearts - [SCIENCE IS EVERYWHERE](https://www.scq.ubc.ca/science-is-everywhere/) - I'm no expert, but even I can see that from the moment you get up in the morning until the moment you nod off to sleep at night, science plays a huge part in your daily life. What's the first thing that happens to you every day? You're jolted awake by the alarm on your - [RESEARCH MANUSCRIPT: SCIENTISTS WILL GEEK OUT UNDER ANY CIRCUMSTANCES](https://www.scq.ubc.ca/research-manuscript-scientists-will-geek-out-under-any-circumstances/) - HYPOTHESIS Scienceful types will find über-nerdy ways to pass the time regardless of the circumstances. MATERIALS AND METHODS: A bunch of scientists went to a bar after a day at a conference. Many consumed unspecified volumes of alcohol. RESULTS: The next day, one of the authors found the following on a napkin he had pocketed: - [A GIANT LEAP FORWARD: CAREGIVERS OF ADVANCED CANCER PATIENTS BECOME ANXIOUS AND DEPRESSED.](https://www.scq.ubc.ca/a-giant-leap-forward-caregivers-of-advanced-cancer-patients-become-anxious-and-depressed/) - (In reference to this paper) - - - In a recent issue of Biological Psychology, Ratnakar, et al., sent shock waves through the scientific community when they concluded that "family caregivers of advanced cancer patients undergo anxiety and depression associated with stress." Making yet another daring leap, the intrepid authors suggested that "these changes might - [BAKE FOR A CHANGE 2008: GAME ON!](https://www.scq.ubc.ca/bake-for-a-change-2008-game-on/) - Or as Dave S. (creator of this great idea) might say, can we call it BFAC2008? Anyway, for those of you who have an annual tradition of putting together a gingerbread house, why not do it this year with a sustainability twist? That's right! our sister site's own "Bake for a Change" is a contest - [MY SUBMISSION TO WEIRD TALES MAGAZINE](https://www.scq.ubc.ca/my-submission-to-weird-tales-magazine/) - Weird Tales magazine is a horror, science fiction, and fantasy periodical established in 1923 that became famous for publishing such literary geniuses as H.P. Lovecraft of Cthulhu Mythos fame and Robert E. Howard of Conan the Barbarian fame. The glory days of Weird Tales occurred back in the 20s and 30s and after that time - [THINKING ABOUT A BOOK NOW (WELL AGAIN)](https://www.scq.ubc.ca/thinking-about-a-book-now-well-again/) - We did this a few years back, then got busy, then got very very busy, then got not so busy (but decided to enjoy that), and are now the busiest we've ever been, but thought (for a variety of reasons) to put this out there again... - - - We don't want to actually make - [CAN YOU SOLVE PUZZLE FANTASTICA #3?](https://www.scq.ubc.ca/can-you-solve-puzzle-fantastica-3/) - (Previously: 1 | 2 | 3 | 4) - - - O.K. o.k. so we've been ultra delinquent with keeping on top of the PF3 puzzle, and for that we heartily apologize. But here we go - the proverbial home stretch. As it stands what did happen was that somewhere in the conversation, in the - [INTEGRATION](https://www.scq.ubc.ca/integration/) - Watch/Download the movie (~120Mb mpeg file) image from here | slides - - - Dr. Hadi Dowlatabadi Canada Research Chair, Professor of Applied Mathematics and Global Change. October 24th, 2008 "It's Your Experiment!" Science Teacher Conference. Michael Smith Laboratories, UBC - - - Description: A 25 minute lecture looking at the value of integration in - [STOP ANIMAL VIOLENCE NOW!](https://www.scq.ubc.ca/stop-animal-violence-now/) - Dear Animal Empathizer, It’s a scene that’d be shocking if it wasn’t all too common: An innocent baby seal is stalked, murdered, its skull crushed, its bloodied body used and abused for nefarious purposes. But the perpetrator of this heinous hate crime isn’t a furrier or poacher, protected from punishment by a right-wing “population control” - [THE ARCTIC PLAYGROUND - SHOULDN'T WE DO OUR HOMEWORK BEFORE WE START PLAYING?](https://www.scq.ubc.ca/the-arctic-playground-shouldnt-we-do-our-homework-before-we-start-playing/) - For some a voyage through the Canadian Arctic may be one of the most exciting and thrilling adventures one could dream of: indeed, hundreds of kilometres of virgin land and cold vastness have challenged thousands of explorers in the past. Many of these arctic adventurers shared a common goal: to seek a navigable passage between - [AN ARACHNOLOGICAL GUIDE TO THE SPIDERS FROM MARS](https://www.scq.ubc.ca/an-arachnological-guide-to-the-spiders-from-mars/) - Stardust Dreamweaver (Arachnidius centauri) One of the most deadly of all Martian spiders, the Stardust Dreamweaver doesn’t inject venom into its prey directly. Instead, it surrounds it in a hazy cosmic jive, distracting its victim. Easily trapping its meal, the Stardust Dreamweaver then cocoons it in a hideous kabuki-style space age outfit and subjects it - [TOWARDS SUSTAINABILITY: DOES SCIENCE MATTER?](https://www.scq.ubc.ca/towards-sustainability-does-science-matter/) - -- Watch/Download the movie (~168Mb mpeg file) | image from here -- - - - Dr. William Rees. Professor, School of Community and Regional Planning. October 24th, 2008 "It's Your Experiment!" Science Teacher Conference. Michael Smith Laboratories, UBC - - - Description: A 30 minute lecture looking at whether science is enough. And if not, - [NOTHING TO CROW ABOUT](https://www.scq.ubc.ca/nothing-to-crow-about/) - "Crows seem to be able to use causal reasoning to solve a problem, a feat previously undocumented in any other non-human animal, including chimps." -- NewScientist.com News Service, September 17, 2008 I don't understand what all the fuss is about crows. Sure, they can "fly" and stuff, but come on, they're birds. So what if - [EVALUATION OF BOUYANT, DRAG AND STAR WARS FORCES ON ENT DERIVED ENGINEERED DEBRIS JAMS ](https://www.scq.ubc.ca/evaluation-of-bouyant-drag-and-star-wars-forces-on-ent-derived-engineered-debris-jams/) - Originally under: DARTHOLOMEW VADER AND DROGO PROUDFOOT*, Department of philosophical biology, University of Tatooine at Mos Eiseley. * Direct correspondence to University of the South Farthing, Crickhollow, Buckland Middle Earth. (Also available as a pdf) * * * Abstract: We used computer flow models and high definition vertical and horizontal GPS to measure the stability - [ANOTHER EYE](https://www.scq.ubc.ca/another-eye/) - The Eye followed the rusty-skin fall leaves collapse on their damp-green bed. Razors cut plum clouds, opening a show of sepia sky. To Clove smoke ashes eyes danced, lips dry, exhales of industrial amounts of smoke. Outside, on the faded deck behind his family’s house, is where the Eye spent most of his time, smoking - [SOLAR THERMAL ELECTRIC POWER](https://www.scq.ubc.ca/solar-thermal-electric-power/) - In recent decades, the search for alternative energies has become increasingly important to the average citizen. Whether it’s due to concerns for the environment or worries about shortages in fuel or rising prices, most people agree that other options need to be found. Considering the amazing amount of energy that is showered down upon us - [AN INTELLIGENT DESIGNER ON THE COW](https://www.scq.ubc.ca/an-intelligent-designer-on-the-cow/) - Today, I feel like doing a plant – no, an animal. Yes, today, I am going to make an animal. And it will be a masterpiece. I shall call it the.... No wait! Maybe I should think of the name later. Yes, you should always name your pieces after you have completed them. Better that - [JOURNAL CLUB FIND - INBREEDING IS IN AGAIN?](https://www.scq.ubc.ca/journal-club-find-inbreeding-is-in-again/) - An Association Between the Kinship and Fertility of Human Couples (pdf) Science (2008), 391: 813-816 In which we learn that true love could be where the 3rd or 4th cousin is... - - - ABSTRACT: Previous studies have reported that related human couples tend to produce more children than unrelated couples but have been unable - [TURKEY: CANADA](https://www.scq.ubc.ca/turkey-canada/) - Pretty image by Audubon Happy Thanksgiving! - [THE RNA TIE CLUB AND LESSONS TO BE LEARNED IN HOW TO WIN A NOBEL PRIZE](https://www.scq.ubc.ca/the-rna-tie-club-and-lessons-to-be-learned-in-how-to-win-a-nobel-prize-2/) - - FROM THE ARCHIVE - (It’s Nobel season! Please enjoy a few from our archive on this topic) As of November 2005, 776 Nobel Prizes have been awarded (758 to individuals, 18 to organizations) in physics, chemistry, medicine, literature, peace, and economics. In that same month, according to the U.S. Bureau of Census, there were - [SHAFTED AGAIN BY NOBEL](https://www.scq.ubc.ca/shafted-again-by-nobel-3/) - - FROM THE ARCHIVE - (It's Nobel season! Please enjoy a few from our archive on this topic) I didn't win the Nobel Prize in Physics again this year. What's a guy got to do to win that thing? I was made to win that prize, but for like the umpteenth time in a row - [A SCIENTIST'S GUIDE TO VOTING IN THE CANADIAN FEDERAL ELECTION (IN FLOWCHART FORM) - A SCIENCE CREATIVE QUARTERLY PIN UP (NO. 4)](https://www.scq.ubc.ca/a-scientists-guide-to-voting-in-the-canadian-federal-election-in-flowchart-form-a-science-creative-quarterly-pin-up-no-4/) - (CLICK HERE FOR PIN-UP POSTER - pdf file ~177k) – We suggest photocopying at 129% - LTR to 11×17 – With the Federal Canadian Election is coming up fast! (October 14th), I thought it would be handy to provide a flowchart pin-up detailing the choices you can make based on: i. Wavelength of the Party's - [ON THE SUNNY SIDE OF EFFICIENCY](https://www.scq.ubc.ca/on-the-sunny-side-of-efficiency/) - (This is the fourth installment of the The Wasteful American series. To read the others, click here, here and here) - - - How much energy is wasted as a result of fortifying foods with vitamin D instead of giving everyone a short bath of scrumptious sunlight during the day? Vitamin D3, added to most - [SOME GRANT PROPOSALS FOR NEW SCIENTIFIC RESEARCH](https://www.scq.ubc.ca/some-grant-proposals-for-new-scientific-research/) - Dear National Science Foundation, I was happy to read that you've launched a new transformative R01 program to support "exceptionally innovative, original or unconventional" investigator-initiated research. It's about time! I'm here in the lab in my parents' basement and look forward to hearing back from you or the President or Congress on these proposals that - [ELLIPTICAL THOUGHTS](https://www.scq.ubc.ca/elliptical-thoughts/) - The lives of parallel lines are uneventful: no sudden twists or unexpected turns disturb their single track monotony. And yet they dream of non-Euclidian space where rules are bent and of that infinite horizon where, at last, they'll coincide. Concentric circles, on the other hand have no such hyperbolic hope. They know their limitations. Destined - [TERRY TALKS: APPLICATIONS TO SPEAK (ONE WEEK LEFT!)](https://www.scq.ubc.ca/terry-talks-applications-to-speak-one-week-left/) - (a message from our sister site) THINGS TO AVOID WHEN SPEAKING PUBLICLY Egad! Is it already that close to October 6th! This is our deadline for applying to be one of the inaugural speakers of the Terry talks student conference. Well, the short answer is yes - in fact there is just under a week - [THE TITLE PRETTY MUCH SAYS IT ALL: EJACULATION AS A POTENTIAL TREATMENT OF NASAL CONGESTION IN MATURE MALES](https://www.scq.ubc.ca/the-title-pretty-much-says-it-all-ejaculation-as-a-potential-treatment-of-nasal-congestion-in-mature-males/) - Ejaculation as a potential treatment of nasal congestion in mature males (pdf) The Journal of Medical Hypotheses, 71(2), 2008. In which we learn that a trip to the pharmacy is not always necessary. - - - TEXT: Nasal congestion is defined by the blockage of the nasal passages usually due to membranes lining the nose - [ANGRY WORDS FROM A GNOME WHO TO THIS DAY CONTINUES TO THINK THE HUMAN GENOME PROJECT WAS ACTUALLY THE HUMAN GNOME PROJECT](https://www.scq.ubc.ca/angry-words-from-a-gnome-who-to-this-day-continues-to-think-the-human-genome-project-was-actually-the-human-gnome-project/) - It’s hard to believe that 17 years ago the Human Gnome Project formally began. It was quite frankly a great day for all of us gnomes as we thought we had finally gained the attention and respect we deserved as a community. But 17 years later, we as a community are disappointed, angry, full of - [SOME NEW THINGS YOU CAN POTENTIALLY DO ON MARS NOW THAT WE KNOW ABOUT THE WATER SITUATION](https://www.scq.ubc.ca/some-new-things-you-can-potentially-do-on-mars-now-that-we-know-about-the-water-situation/) - Figure skating Margarita party. Canoe trip. Invest in waterfront property. Baptisms. Preparing juice from concentrate. Hot tubbing! - [THEY ALSO SERVE WHO ONLY STAND AND WAIT](https://www.scq.ubc.ca/they-also-serve-who-only-stand-and-wait/) - Mr. D. is one of those guys who is just nice. He's far from gregarious, but everyone who meets him likes him. He's quiet, reserved, and hates to complain. He's had his share of medical problems over the last 80 years---emphysema, lymphoma, prostate cancer---all of which he's treated as inconveniences. When he came into my - [A WRITING ACTIVITY: ARE YOU THERE HUMANS? IT'S ME, PLASTIC.](https://www.scq.ubc.ca/a-writing-activity-are-you-there-humans-its-me-plastic/) - (pdf of this activity is available for download by clicking here) - - - This workshop aims to teach environmental and social responsibility while exercising student empathy by having students write letters from the point of view of inanimate objects or animals. Coincidentally, good writing habits and understanding of narrative techniques are developed in the - [THROWING MONEY AWAY (A MODEST PROPOSAL)](https://www.scq.ubc.ca/throwing-money-away-a-modest-proposal/) - (This is the third installment of the The Wasteful American series. To read the others, click here and here) - - - In America, it is a relatively common bit of trivia that producing a penny costs more than one cent (its street value).[1] Someday, we will likely follow Canada's syrupy example and make coins - [HUMAN GENE COMMONLY ASSOCIATED WITH CANCER OR DROID FROM STAR WARS?](https://www.scq.ubc.ca/human-gene-commonly-associated-with-cancer-or-droid-from-star-wars/) - 1. p21RAS 2. C-3PO 3. CD45 4. p53 5. C-SRC 6. RIC-920 7. FOS-JUN 8. R2-D2 9. 8D8 10. C-MYC 1, 3, 4, 5, 7, 10 are oncogenes: 2, 6, 8, 9 are droids from Star Wars. - [THE GENE DJINNI](https://www.scq.ubc.ca/the-gene-djinni/) - Scientists have been homing in on the genes that define our sense of humour. In a follow-up to the research which brought us British Humour Linked to Genetics, the latest report claims they have come up with some "funny results". It does not specify whether said results are funny ha-ha or funny peculiar. Humanity has - [ANOTHER BOOK TO WIN: THIS ONE IS CALLED "FOLLOW THE LINE AROUND THE WORLD."](https://www.scq.ubc.ca/another-book-to-win-this-one-is-called-follow-the-line-around-the-world/) - The SCQ is pleased to announce that the winner of the last book was Alex Roger's "Astro I Reference Notes." To keep things rolling a little bit, we would like to present the next book up for grabs. This one is called "Follow the Line Around the World" by Laura Ljungkvist. We think every reader - [FROM THE COLLECTION NO IRON RING (THIRD)](https://www.scq.ubc.ca/from-the-collection-no-iron-ring-third/) - the bridge is singular it asserts its beauty as verisimilitude of form its presence is a provocation a displacement of the natural strung like a witness over incremental depths the tenants of this occupation suppose the iron ordinance of stasis a beauty that refuses to be held entirely bridging precipice to precipice a band of - [FROM THE COLLECTION NO IRON RING (SECOND)](https://www.scq.ubc.ca/from-the-collection-no-iron-ring-second/) - notions of hydrography piers from the channel the object imbued with conditional phrases contextual meaning a hydrostatic balance if you will, are, of, but not consumed by the Kitsap peninsula 5979 feet minus 40 reciprocal inductions during the rise and fall of several feet in 4-5 seconds a balletic guise 47˚16’00” N coordinates once negating - [SUPER-BRANDING HITS MOLECULAR BIOLOGY](https://www.scq.ubc.ca/super-branding-hits-molecular-biology/) - 1. Mass Spectrometry, now with an iDock! 2. X-ray crystallography, now with a Sears automatic ice-maker! 3. SDS-Polyacrylamide gel electrophoresis, now with Tide! 4. Differential Scanning Calorimetry, now with a Starbucks espresso maker! 5. UV/Vis Spectrophotometry, now with Coppertone sunblock! 6. Automated DNA Sequencing, now with 200 free anytime minutes a month from Verizon! 7. - [ASTRO I REFERENCE NOTES](https://www.scq.ubc.ca/astro-i-reference-notes/) - The amount of energy required by gravity to hold the Earth together is called "Gravitational Binding Energy. If we were to build a device capable of generating an amount of energy equal to the paltry sum of 1 GBE we could easily destroy this measly planet, unless of course the UN sees things my way - [FROM THE COLLECTION NO IRON RING (FIRST)](https://www.scq.ubc.ca/from-the-collection-no-iron-ring-first/) - This poem (and two others to be published in the coming days) are part of a growing sequence that is titled "No Iron Ring" and is making an analogous object out of the construction, edifice and ultimate destruction of the Tacoma Narrows Bridge. The ring functions as a symbol of engineering pride, fellowship and a - [WHAT KIND OF ENGINEER IS GOD? (A NEW SPIN OF AN OLD JOKE)](https://www.scq.ubc.ca/what-kind-of-engineer-is-god-a-new-spin-of-an-old-joke/) - One very fine day, a group of professorial-types of differing backgrounds happened at random to collude at the same table in the University cafeteria. Their conversation evolved from small talk into more substantive topics, and eventually the Professor of Civil Engineering, with a mischievous grin, posed the question, "What kind of a Scientist is god?" - [SCIENCE IS GOING TO KILL US ALL](https://www.scq.ubc.ca/science-is-going-to-kill-us-all/) - The world is going to end on December 21st 2012. How do I know this? Because the Mayans said so and the Mayans pretty much knew it all; these are people that calculated the length of a year to a thousandth decimal place, predicted all future lunar and solar eclipses and invented gravity*. They were - [ATMOSPHERIC STUDIES](https://www.scq.ubc.ca/atmospheric-studies/) - I am on the side of humanity and truth. I agree to be accountable to you Because I am a sucker for a grown-up: I forget adults do not exist. I have a safety deposit box where I confess my pretexts. Among them: I have known monsters without becoming monstrous. I have longed for peace - [LIKELY AND UNLIKELY THINGS THAT SIR ISAAC NEWTON STOOD ON DURING HIS LIFETIME. ](https://www.scq.ubc.ca/likely-and-unlikely-things-that-sir-isaac-newton-stood-on-during-his-lifetime/) - Likely: Grass. A stage of some sort. Guard. Tippy toes. Unlikely Astroturf. Olympic podium. Someone's throat. Shoulders of (Real) Giants. - [THINGS TO AVOID WHEN SPEAKING PUBLICLY (VIDEO VERSION)](https://www.scq.ubc.ca/things-to-avoid-when-speaking-publicly-video-version/) - The SCQ will recommence as of Wednesday, September the 3rd with our regular programming, but in the meantime, please let us introduce Terry talks - a student conference hosted by our sister site at terry.ubc.ca. "Imagine UBC’s most fascinating and engaging students coming together for a day, giving ‘the talk of their lives,’ sharing their - [MARINE MOLLUSC (A HAIKU ON APLYSIA CALIFORNICA)](https://www.scq.ubc.ca/marine-mollusc-a-haiku-on-aplysia-californica/) - Aplysia (snail) bunny of the pacific hydroskeleton - - - (And also to say, that at long last our haiku phylogeny project will be coming to a close - stay tuned this fall...) - [THINGS TO AVOID AT ALL COST WHEN SPEAKING PUBLICLY](https://www.scq.ubc.ca/things-to-avoid-at-all-cost-when-speaking-publicly/) - (A public service announcement) - - - Vomiting. Aggressive sweating. Evil powerpoint slides. B.S. Spitting. Mumbling. Multiple shots of that animal or flower you saw during your vacation, that yes, while interesting, does not need more than one slide in your talk. Non-mocking, gratuitous product placements. Fake accents. Wardrobe malfunctions. Being under the influence. Slides - [HAPPY 500 (OR SO) DAYS FOR THE SCIENCE SCOUTS - A LITTLE GET TOGETHER THIS COMING FRIDAY FOR ALL YOU VANCOUVERITES READING THE QUARTERLY](https://www.scq.ubc.ca/happy-500-or-so-days-for-the-science-scouts-a-little-get-together-this-coming-friday-for-all-you-vancouverites-reading-the-quarterly/) - Just a quick note. Although it's been a while, a few of us are meeting for drinks on Friday night (July 25th) at The Revel Room in Gastown, Vancouver (8pm on). It just so happens that it's about the 500th Day Anniversary of the Science Scouts. What's this? Well, it's this. Think: science plus badges - [AN EXAMPLE OF SPIN](https://www.scq.ubc.ca/an-example-of-spin/) - Link to commentary here. - [SCIENCEGEEK LOVE AD](https://www.scq.ubc.ca/sciencegeek-love-ad/) - Link to commentary here. - [THE SCQ'S MONTHLY CHILDREN'S BOOK WRITING CONTEST: BACK ON](https://www.scq.ubc.ca/the-scqs-monthly-childrens-book-writing-contest-back-on/) - We have been neglectful for the last 5 months, but here we are back again. Once again, the SCQ is seeking general submissions, where any submission that makes its way to our pages is a contender, The one that we receive before the end of August that we happen to like the best will be - [TWO BACK FLIPS](https://www.scq.ubc.ca/two-back-flips/) - Dear Mom and Dad, I hae been turned into a wasp. Please bear with me being a wasp. I live in a hive now. Also, let Joe have my room and money, since I'm a wasp and I don't need money. Love Matt. p.s. I will fly in the house and do two back flips, - [BEING AN INSECT IS CERTAINLY NOT EASY.](https://www.scq.ubc.ca/being-an-insect-is-certainly-not-easy/) - Being an insect is certainly not easy. Having two long antennae, six legs, two wings, and three body segments, I make people become afraid of me. They may step on me because of their fear, or they might keep me in a cage. Also, it is extremely hard to defend myself against these threats. I - [HELP ME!](https://www.scq.ubc.ca/help-me/) - Help me! I don't know what I am, or what happened, but I have six legs and wings. When I walked flew into school, I almost got crushed! HELP! p.s. If you don't recognize me, that's normal... - - - These pieces were composed during the May 13th session of the Science Creative Literacy Symposia. - [I'VE BEEN TURNED INTO A BIG INSECT!](https://www.scq.ubc.ca/ive-been-turned-into-a-big-insect/) - Dear Family, I've been turned into a big insect! Everything is so much bigger, and I feel so insignificant. My legs feel so funny now, apart from the fact that I have six of them. I have a heavy hard shell, and two long antennae. Although everything's much different, some things are easier. I can - [COLLECTED WORKS FROM DR. GEORGE WIER ELEMENTARY, MAY 13th 2008](https://www.scq.ubc.ca/collected-works-from-dr-george-wier-elementary-may-13th-2008/) - These pieces were composed during the May 13th session of the Science Creative Literacy Symposia. During this day, students examined the many wonders of insects (using microscopes, and from resin collections, as well as from the Spencer Entomology Collection). Afterwards, students were then asked to design their own insect, as well as compose a postcard - [A LEAF](https://www.scq.ubc.ca/a-leaf/) - I am one of the million leaves in the wild. I am Red. Autumn has given me my bright red dress. Now, I am one of the leaves in the sea of red. I am white. Don't ask why, because We all know If you really can't guess, you shall go ask snow. I am - [LIFE AS A KIWI](https://www.scq.ubc.ca/life-as-a-kiwi/) - life as a kiwi is tough because going through the intestines sucks. growing stabs knifes through your fuzzy skin, your flesh being ripped apart by jagged white monsters sucks. trying to portray the stereotype of the "kiwi" plump, juicy, tasty, sucks. knowing that your mother tree grew you to be eaten sucks. life as a - [UNTITLED](https://www.scq.ubc.ca/untitled-2/) - I can just imagine. Looking down on everyone else. Not being short. - - - This piece was composed during the May 5th session of the Science Creative Literacy Symposia. During this day, students performed a few biology experiments that examined change (DNA isolation from Kiwi, and a pineapple enzymatic degradation of jello). Afterwards, students - [I DON'T LIKE CATS](https://www.scq.ubc.ca/i-dont-like-cats/) - I don't like cats They meow and scratch they never like to be pet they keep you awake with their stupid purrs they cuddle in your bed they're so soft and fluffy they're fun to play with so cute and adorable I love my cat! - - - This piece was composed during the May - [WHITE](https://www.scq.ubc.ca/white/) - The underbelly of a tiger, The bald head from an eagle. A gentle feather from a swan It surrounds nature in many ways. Be aware of the place it's used. - - - This piece was composed during the May 5th session of the Science Creative Literacy Symposia. During this day, students performed a few - [COLLECTED WORKS FROM IRWIN PARK ELEMENTARY, MAY 5th 2008](https://www.scq.ubc.ca/collected-works-from-irwin-park-elementary-may-5th-2008/) - These pieces were composed during the May 5th session of the Science Creative Literacy Symposia. During this day, students performed a few biology experiments that examined change (DNA isolation from Kiwi, and a pineapple enzymatic degradation of jello). Afterwards, students were then asked to create poetry, again examining a subject in light of different perspectives. - [HOW DO I LOVE THEE BRAIN, LET ME COUNT THE WAYS](https://www.scq.ubc.ca/how-do-i-love-thee-brain-let-me-count-the-ways/) - How do I love thee brain? Let me count the ways. I love thy neurons which communicate with the rest of my body. I love thy neocortex for allowing my senses to work. My soul reaches out to you. I love you to your cerebellum for integrating my senses with movement. I love your river-like - [BRAIN, HOW DO I LOVE THEE?](https://www.scq.ubc.ca/brain-how-do-i-love-thee/) - How do I love you? Let me count the ways. You are working tirelessly, never ceasing to stop. Working day after day, your cerebellum is always on top. You let me feel, smell, see, hear, and taste. You tell my body to kill the germs when I eat an icky paste. Your hormones are always - [A LETTER TO MY BRAIN](https://www.scq.ubc.ca/a-letter-to-my-brain/) - Dear Brain, How do I love thee? Let me count the ways. You help me write this very loving poem to you like the moon helping the water make tides. You also help me learn how you work, like a toddler learning the ABC’s. Finally, you allow me to understand that I actually exist on - [HOW DO I LOVE THEE HEART?](https://www.scq.ubc.ca/how-do-i-love-thee-heart/) - How do I love thee heart? Let me count the ways. I love the way you beat when you smell bacon. I love you so much that I will never swallow any gum so I won’t form a ring around you. So I can see your beautiful veins every day. You are like my fins - [HOW DO I HATE THEE ALZHEIMERS?](https://www.scq.ubc.ca/how-do-i-hate-thee-alzheimers/) - How do I hate thee Alzheimers? Let me count the ways. Confusion, anger, memory loss - it’s like a giant maze. Twists and turns in emotional sorrow that will still continue on tomorrow. For some very unfortunate people this is the way of life, for how would you feel if this was you or someone - [PROJECT STEVE: 889 STEVES FIGHT BACK AGAINST ANTI-EVOLUTION PROPOGANDA](https://www.scq.ubc.ca/project-steve-889-steves-fight-back-against-anti-evolution-propoganda/) - As many scientists and science educators are aware, the Discovery Institute, a conservative Christian think tank based in Seattle, Washington, maintains a list of signatories -- the Institute calls them scientists, and calls the list "A Scientific Dissent From Darwinism" -- under the following claim: "We are skeptical of claims for the ability of random - [CONSTANT](https://www.scq.ubc.ca/constant/) - Dark matter of my heart – you can bruise and bully, but still the impulse to take care rises like the universe that throws up its hands, and never brings them back down again. Their ascent speeds until fingers fly apart, manicured fireworks – and my heart, too, is reeling out in many universes: a - [EXPLAINING OUR WORLD: SCIENCE VS. CREATIONISM](https://www.scq.ubc.ca/explaining-our-world-science-vs-creationism/) - The Coccyx, or Tail Bone Science: Our predecessors had tails, and we retain these bones because our gluteus maximus and other muscles need something to anchor them. The coccyx also serves as a shock absorber when we fall on our rump. Creationism: Ironic that science would use such a tall tale to explain a short - [MY FAVOURITE BIRD IS A SMALL-MOUTHED SALAMANDER](https://www.scq.ubc.ca/my-favourite-bird-is-a-small-mouthed-salamander/) - It is early on a rainy March morning. My daughter, Klara, and I stand together – holding hands in the midst of a circle of people we do not know. Rain drips off the tip of her nose and she catches it with her tongue as she waits for the formalities to end and the - [COLLECTED WORKS FROM MANOAH STEVES ELEMENTARY, MAY 14th 2008](https://www.scq.ubc.ca/collected-works-from-manoah-steves-elementary-may-14th-2008/) - These pieces were composed during the May 14th session of the Science Creative Literacy Symposia. During this day, students were given a tour of various human organ systems, and allowed a chance to explore them with microscopes. Afterwards, students were then asked to compose an ode to an organ of their choice. Herein we present - [COLLECTED WORKS FROM ADMIRAL SEYMOUR ELEMENTARY, MAY 9th 2008](https://www.scq.ubc.ca/collected-works-from-admiral-seymour-elementary-may-9th-2008/) - These pieces were composed during the May 9th session of the Science Creative Literacy Symposia. During this day, students were guided through the construction of three aquatic biospheres, and were then asked to compose a letter from something or someone that is "voiceless," but might nevertheless have something to say. - - - A LETTER - [A LETTER FROM A TOP SECRET WOODPECKER TO THE HUMAN LEADER OF CANADA](https://www.scq.ubc.ca/a-letter-from-a-top-secret-woodpecker-to-the-human-leader-of-canada/) - Attn: Human Leader of Canada To the Human Leader of Canada, Greetings from all Woodpeckers. We send this letter as a warning, but also as a letter heralding the beginning of a possible alliance. Our outpost on Pender Island, off the West coast of your country called Canada, as well as our other major outposts - [A LETTER FROM BOB DOUGH, GREEN SEA TURTLE, TO ANY LIFE ON MARS.](https://www.scq.ubc.ca/a-letter-from-bob-dough-green-sea-turtle-to-any-life-on-mars/) - Attn: Any Life on Mars 4444 Marstreet Mars, Santorus Dear Martians, If you obtain this letter, please read. Us sea turtles are being slowly killed by those darn humans. I decided to write this letter to any life on another planet. I cannot stand to see any more of my fellow turtles die like this. - [A LETTER FROM DOLPH THE DOLPHIN TO A GEORGE WASHINGTON LIVING IN COLORADO](https://www.scq.ubc.ca/a-letter-from-dolph-the-dolphin-to-a-george-washington-living-in-colorado/) - Attn: George Washington 1842 Arizona Ave. 784 Denver, Colorado Dear George W., Have we ever met? Once? Twice? Never? Man! How is it in the States? It is so much fun in the water. A lot of dolphins are building new homes so we can live and have fun in the water. We can do - [A LETTER FROM FRED McCHICKEN TO OLD MACDONALD](https://www.scq.ubc.ca/a-letter-from-fred-mcchicken-to-old-macdonald/) - Attn: Old McDonald 2745 Barn St. Chickenland, Canada Dear Old McDonald, I am writing on behalf of all the chickens on your farm. Life in this barn is very uncomfortable. We’re stuck in this barn 24/7. We never get to go and play with the chickens across the street. Last week, my friend George invited - [A LETTER FROM LIZZIE THE ZEBRA TO ANYONE WHO CARES](https://www.scq.ubc.ca/a-letter-from-lizzie-the-zebra-to-anyone-who-cares/) - Attn: Anyone Who Cares Anywhere. Dear Anyone Who Cares, I would just like to let you know why I am writing this letter. I hope that all of you that are living in a wonderful world could care about my world. We all live in the same world, but others live in this world differently. - [WHY I DO SCIENCE](https://www.scq.ubc.ca/why-i-do-science/) - When I look out my office window, I see two sets of nucleotide bases – guanine and cytosine. I don’t mention this as an admission of psychotic delirium. The building where I work just happens to have a DNA molecule emblazoned on its windows. Admittedly, it’s an odd workplace view, but in my case it - [THE PROBLEM OF PRIOR KNOWLEDGE](https://www.scq.ubc.ca/the-problem-of-prior-knowledge/) - —And today we are pleased to welcome the notorious “atheist creationist.” Thank you for joining us, Dr. Kranish. —Your sobriquet is only half right, but I accept it. It got me on your show. I’m making a fortune. —Why, Dr. Kranish, you sound positively cynical. “When you’re dead, you’re dead,” declares Stanley Kranish, disgraced engineering - [THE BEAST](https://www.scq.ubc.ca/the-beast/) - Mallika and Anne approach the school on bikes. Mallika: It's so nice out today! The sun's out an the birds are chirping! She sighs and smiles. Anne: Yes, it's a great day for bike riding. Mallika nods in agreement. Drew enters quickly in an SUV and almost runs Mallika and Anne over. Mallika: HEY! Watch - [HELA VS JLO: THE FINAL SHOWDOWN](https://www.scq.ubc.ca/hela-vs-jlo-the-final-showdown/) - (HeLa refers to this, JLo to this) HeLa: Cancer. JLo: Not cancer. Advantage: JLo. HeLa: Supreme longevity. JLo: Not so supreme longevity. Advantage: HeLa. HeLa: Interesting model system. JLo: Interesting model. Advantage: JLo. HeLa: Adherent. JLo: "Clingy" Advantage: HeLa. HeLa: No flim credits to date. JLo: Co-starred in underrated movie with George Clooney. Advantage: JLo. - [HEY CARL!](https://www.scq.ubc.ca/hey-carl/) - SETTING: Carl's house. Joe: Hey Carl! What's up? Carl: Just sitting and throwing away recyclables... It's really fun Carl is throwing stuff. Mariah: Why are you just throwing away recyclables for fun? Carl: 'Cause it's fun! Joe: Recyclables are called recyclables because they're supposed to be recyclable in the recyclable bin, which is why they're - [GO SEE A MOVIE](https://www.scq.ubc.ca/go-see-a-movie/) - Three teenagers are hanging out, when Joe drops his cigarette butt on the ground. Zoey gets mad at Joe for polluting the environment. Zoey: Hey! Joe... Joe, you just accidentally dropped your cigarette butt on the ground. Joe rolls his eyes. Joe: That wasn't an accident. Zoey gets VERY mad. Zoey THERE IS AN ASH - [CHRISTINA AND HER AEROSOL CAN](https://www.scq.ubc.ca/christina-and-her-aerosol-can/) - Christina wakes up with a huge smile. Christina: Yay! It's finally summer! Wind comes and Christina shivers. Christina: Oh my gosh, it's freezing cold today! I guess it's time to bring out the aerosol cans! Christina brings out the aerosol cans and walks outside and starts to spray the cans while humming the "song." Elif - [CORNELIUS OAK](https://www.scq.ubc.ca/cornelius-oak/) - SETTING: A neighbourhood street, two people and a tree. Blaire: Hey Danny, it's a beautiful day today. Danny: It sure is! Look at that weak sickly tree over there. Cornelius Oak: It's not my fault! Blaire and Danny are startled. It's the human's fault that I look like this. Blaire: Who was that? Danny: It - [A LIST OF PROMISING SALES SLOGANS THAT THE TOY MANUFACTERER, MATTEL, COULD POTENTIALLY USE IF THEY EVER DECIDE TO MASS-PRODUCE AND MARKET A “STEM CELL BARBIE.”](https://www.scq.ubc.ca/a-list-of-promising-sales-slogans-that-the-toy-manufacterer-mattel-could-potentially-use-if-they-ever-decide-to-mass-produce-and-market-a-“stem-cell-barbie”/) - “Hey kids, this Barbie might get pregnant!” “Comes with refrigerated unit to prevent mold.” “Stem Cell Barbie uses only materials from the 60 cell lines approved by George W. Bush himself.” “See Barbie scab!” “Watch her fall in love with Cadaver Ken!” “Have fun with your religious friends – tell them she’s made from embryos!” - [GEOL 1000: SUBDUCTION CAUSES OROGENY](https://www.scq.ubc.ca/geog-1000-subduction-causes-orogeny/) - I've always loved geology. I don't know why I do, but something 'bout the changing earth excites me through and through. Subduction zones, orogeny, the earth's great heaving powers, and cleavage, groins, and hot spots. I could study this for hours. I love to learn of hardness, swells, and continental rise; of columns, stacks, and - [BIOSPHERE REPORT CENTRE](https://www.scq.ubc.ca/biosphere-report-centre/) - This page is the report centre for three biopsheres set up with a class from Vancouver's Admiral Seymour Elementary School. This is part of the pilot run for the Science Creative Literacy Symposia. Full details for setting up the biosphere can be found at Martin John Brown's website (direct link pdf of article published in - [BISPHENOL-A: THE ONE-ACT PLAY](https://www.scq.ubc.ca/bisphenol-a-the-one-act-play/) - Our evening began in Peter Seychelles comfortable study in his New York townhouse, where the candlelight was just right, the hi-fi was in the background, and the Bisphenol-A was causing a stir. - - - Narrator: A worried friend rushes in worried about recent plastics news. She is worried. The scene is set. Worried Friend, - [COLUMN CHROMATOGRAPHY](https://www.scq.ubc.ca/column-chromatography-2/) - Purple powder gently falling Safely in my hands Mixing it, shaking it, pouring it Suddenly it forms bands Coming back, finding it Red between white In the light. Picking flowers when I was three Scattering them next to my mother, On a tree Cherry blossoms in my hand Gently land On the sand Of the - [COLUMN CHROMATOGRAPHY](https://www.scq.ubc.ca/column-chromatography-3/) - We walked into the lab full of science. Promise for work, excitement, and discovery awaited We had an experiment to do We picked a plant, pink, purple or green We went up in groups refining it Turning it to powder with a crackling and squelching The nitrogen froze it brittle we ground it mortar and - [HIS PURPLENESS](https://www.scq.ubc.ca/his-purpleness/) - Shining. Draped in purple. The fresh smell. It calls to me. Mortar and pestle. Grinding. Crushing. Destroying the beauty that once was. Beauty lost, never to be regained. A last chance to recover: Acetone. Bringing back what once was? Purple to brown. Beauty to hideousness. They say we have gained, but forget about what we - [COLUMN CHROMATOGRAPHY](https://www.scq.ubc.ca/column-chromatography/) - It started with an empty tube Filled with a murky green liquid, Clumps of plant clung on to the sides. Left to settle, the plant material and liquid eventually separated, Like oil and water. Extracting the liquid from the test tube, We mixed it into a combination of ethanol and silica. The solvent tore it - [RUBBER GLOVES](https://www.scq.ubc.ca/rubber-gloves/) - This poem is a collective construction from one of our symposia days. Each student wrote one line about the topic they chose (rubber gloves), and then the students put the lines in order to create a poem. The instructors let the students have free reign over their collective creative process, and they wrote it and - [COLLECTED WORKS FROM TECUMSEH ELEMENTARY SCHOOL, MAY 8th 2008](https://www.scq.ubc.ca/collected-works-from-tecumseh-elementary-school-may-8th-2008/) - Part of our Science Creative Literary Symposia. During this day, students from the Grade 7 class extracted compounds from various plant and flower samples, which were then loaded on a silica based chromatography column for characterization. - - - THE DIAMED FLOWER The DiaMed flower Magenta petals, Slightly browning, Texture of satin, In a single - [A REVIEW OF “MOLECULAR REGULATION OF 23A2 SKELETAL MYOBLAST DIFFERENTIATION AND APOPTOSIS” BY DR. MARGOT FREER](https://www.scq.ubc.ca/a-review-of-“molecular-regulation-of-23a2-skeletal-myoblast-differentiation-and-apoptosis”-by-dr-margot-freer/) - (In the interest of full disclosure, it is worth saying that Justin has known the author for several years. Further, the author has often provided Justin with home cooked meals and emotional support following his frequent, painful breakups and other various frequent personal tragedies. Finally, it is the present reviewer’s opinion that as he received - [ODE TO A WHOPPING URN](https://www.scq.ubc.ca/ode-to-a-whopping-urn/) - A rap song - audio file here If the haze in my brain is smog what do you call the apathy of the cog inside the giant corporate shell. But truly I know this isn't hell. So global warming may make us all blond, ironic the hockey stick will close my ponds And where did - [THE CHALLENGES THAT THE GLOBAL POLIO ERADICATION INITIATIVE FACES. ](https://www.scq.ubc.ca/the-challenges-that-the-global-polio-eradication-initiative-faces/) - In the last few decades, we have been able to curb the number of children affected by polio and the number of countries harbouring the virus with great success. This is made possible by the introduction of two very efficient vaccines and the establishment of a global mass-scale immunisation campaign that has already administered 10 - [COOKING WITH ARCHIMEDES](https://www.scq.ubc.ca/cooking-with-archimedes/) - Cool dove, white and earth-bound, ambient cheek bones fluffing until some scare brings flight, and the color scheme of bouncing light. My eyes ripple, debris settling into image. In your hair, the smell of bay bonded to purple onion, red and green tomato stripes, stoplight peppers sparking sweet and tart reactions. I inhale; my stomach - [WHAT RULES THE WORLD?](https://www.scq.ubc.ca/what-rules-the-world/) - Henry de la Beche's "Duria Antiquior," an image of the carnage that must have taken place on the shores of the ancient Dorset. Years ago, when touring dino-mation exhibits were all the rage, my parents took me to "see the dinosaurs" at the Morris Museum. I was terrified. I had seen dinosaur skeletons before, but - [HAYPENNY EMAIL SUBMISSIONS GUIDE](https://www.scq.ubc.ca/haypenny-email-submissions-guide/) - It is the opinion of the editors that Haypenny is nothing without its readers, and it is here on the Email page that readers have the opportunity to speak up about whatever is on their collective mind. So please, feel free to submit your comment to the editors by using the link below. comments@haypenny.com It - [ANNOUNCING OUR PROFESSIONAL MOLECULAR BIOLOGY WORKSHOP
JULY 21 - JULY 25, 2008](https://www.scq.ubc.ca/announcing-our-professional-molecular-biology-workshop-july-21-july-25-2008/) - MOLECULAR BIOLOGY TECHNIQUES WORKSHOPS (SUMMER 2008 PROGRAM): Now accepting registration To register, please contact Dr. David Ng at db@interchange.ubc.ca (1) ONE WEEK VERSION Dates: July 21st - 25th, 2008 Price: CAN$1250 (does not include room or board) Reviews and Testimonies Can be found here. INSTRUCTOR: Dr. David Ng DESCRIPTION: This intense one week workshop will - [A PROCRASTINATOR’S GUIDE TO THE UNIVERSE (OR IN DEFENSE OF DELAYING THE INEVITABLE)](https://www.scq.ubc.ca/a-procrastinator’s-guide-the-universe-or-in-defense-of-delaying-the-inevitable/) - Empirical research would suggest that almost 90% of people are chronic procrastinators, with acute exacerbations occurring most frequently in student populations[1]. Given the incidence of this condition in the general population, it appears possible – even likely – that this behavior confers selective advantage, and since this trait enjoys continued popularity and prevalence in our - [THE HMS BEAGLE PROJECT - A SCIENCE CREATIVE QUARTERLY PIN UP (NO. 3)](https://www.scq.ubc.ca/the-hms-beagle-project-a-science-creative-quarterly-pin-up-no-3/) - (CLICK HERE FOR PIN-UP POSTER - pdf file ~200k) – We suggest photocopying at 129% - LTR to 11×17 – My wish was to be buried in the Churchyard at Downe. Now I find Mr Huxley, thumbing his nose at the Queen for refusing me a knighthood, arranged to have me planted in that mausoleum - [INNUMERACY](https://www.scq.ubc.ca/innumeracy/) - White pear blossoms blurring on the downhill stride; cloud veins branching, bursting blue-blood lights and streaks; marmalade fractal-smudged bites in a Sunday; points on the mounts' horizon, range upon range dipping over the edge of the world; angles drawn with straight lines on that world, bending Euclid, because they can, because they must – no - [JOURNAL CLUB FIND: SOMETHING ABOUT MATING WITH YOUR COUSINS IS A GOOD THING?](https://www.scq.ubc.ca/journal-club-find-something-about-mating-with-your-cousins-is-a-good-thing/) - An Association Between the Kinship and Fertility of Human Couples (pdf). Science 8 February 2008: Vol. 319. no. 5864, pp. 813 - 816 To quote... "greatest reproductive success observed for couples related at the level of third and fourth cousins" and as if tables like below really take away from the "ick" factor. ABSTRACT: Previous - [IT'S OFFICIAL - INTRODUCING THE "SCIENCE CREATIVE LITERACY SYMPOSIA"](https://www.scq.ubc.ca/its-official-introducing-the-science-creative-literacy-symposia/) - Presumably, art and sciences interact a little like this? The Science Creative Literacy Symposia is a new fieldtrip program offered at the University of British Columbia, and is designed to provide an engaging outreach experience for students at the Grade 6/7 level. Here, the intent is to combine elements of science exploration with expository creative - [A LITTLE HIKE](https://www.scq.ubc.ca/a-little-hike/) - FADE IN: Dialogue in Mandarin with English subtitles. An impoverished rural village in contemporary China. EXT. A SMALL WOODEN HOUSE - - DAY MAMA, a single mother of three children in her mid 30’s, walks along a dusty dirt road into a meek wooden house lugging a heavy pail of water. A shabby cloth hangs - [TARGETING TELOMERES AND CANCER FOR 'DUMMIӘS'](https://www.scq.ubc.ca/targeting-telomeres-and-cancer-for-dummiәs/) - For ‘Dummies’ is a simple yet powerful publishing genre to alleviate the anxiety and frustration people feel about understanding complicated material by mocking them with insightful and educational descriptions, making difficult material interesting and easy to understand. One of the most widespread and complicated diseases affecting us today is cancer. Everyone’s heard about cancer, but - [BC YOUTHS RECEIVE RICH SCIENCE AND ENGINEERING TALKS ON EARTH DAY WEEKEND (PLUS A GLIMPSE INTO TRIUMF’S SATURDAY MORNING LECTURE SERIES).](https://www.scq.ubc.ca/bc-youths-receive-rich-science-and-engineering-talks-on-earth-day-weekend-plus-a-glimpse-into-triumf’s-saturday-morning-lecture-series/) - (This piece is about Earth Day last year - and to also note that this year’s Earth Day is coming up on April 22nd) - - - It promised to be a great weekend. Earth Day was just around the corner. And ready for that occasion, the TRIUMF research facility on south campus was set - [THE MYTHOLOGY – AND POTENTIAL – OF THE PUBLIC INTELLECTUAL. LEARNING FROM RACHEL CARSON](https://www.scq.ubc.ca/the-mythology-–-and-potential-–-of-the-public-intellectual-learning-from-rachel-carson/) - “It is the public that is being asked to assume the risks...the public must decide whether it wishes to continue on the present road, and it can only do so when in full possession of the facts...”[1] In her crusade to galvanize the American public against what she considered an insidious enemy masquerading as progress, - [OBSERVATIONS / REFLECTIONS ON STATUS QUO](https://www.scq.ubc.ca/observations-reflections-on-status-quo/) - 1. Trees in the city (at winter) we are surrounded by pavement. shallow roots and bare branches. perhaps strung with christmas lights or strangled by these strings of lights? fragile / frail / awkward we stand in parking lots, by sidewalks – illusions that the city has not been taken over by concrete and pavement. - [CAN YOU SOLVE PUZZLE FANTASTICA #3? - THE FINAL CLUE](https://www.scq.ubc.ca/can-you-solve-puzzle-fantastica-3-the-final-clue/) - "It's all about the pork products..." For a more detailed look at the first 4 clues, see below. If you've got one, leave an answer here. Good luck! - - - Clue 1 Clue 2 Clue 3 Clue 4 - [A NON-COMPREHENSIVE LIST OF 10 WAYS PHYSICAL CHEMISTS MAKE YOUR LIFE MORE COMPLICATED](https://www.scq.ubc.ca/a-non-comprehensive-list-of-10-ways-physical-chemists-make-your-life-more-complicated/) - 10. This list is in octal for theoretical reasons that are currently un-testable by any known technique. 7. You always feel "dirty" when you use an approximation, or round to three significant figures. 6. For a while you believed that there really were practical applications for the Schrödinger equation. That's four months of your life - [DETECTION OF LARGE WOODY DEBRIS ACCUMULATIONS IN OLD-GROWTH FORESTS USING SONIC WAVE COLLECTION](https://www.scq.ubc.ca/detection-of-large-woody-debris-accumulations-in-old-growth-forests-using-sonic-wave-collection/) - Originally under: INDIANA R. JONES AND ETHAN ALLEN (“ET AL” FOR SHORT), Department of philosophical biology, University of North Dakota at Hoople Earl’s Corner Bar, Main Street, Hoople, ND (Also available as a pdf file) * * * Abstract: We used directional microphones, professional electronic audio recording equipment and personal observation to monitor the accumulation - [YOUR EPIGENOME AND YOU: A BRIEF INTRODUCTION TO WHAT YOUR EPIGENOME DOES FOR YOU, AND WHAT YOU CAN DO FOR YOUR EPIGENOME.](https://www.scq.ubc.ca/your-epigenome-and-you-a-brief-introduction-to-what-your-epigenome-does-for-you-and-what-you-can-do-for-your-epigenome/) - DNA is a curious thing. It might make sense for you to think about the DNA in your brain in terms of “brain DNA” and DNA in your blood in terms of “blood DNA”, but you’d be wrong. Strangely, the DNA in your skin cells sloughing off to make up a considerable proportion of common - [PUBLIC TELEVISION PRESENTS, “NATUREWORLD: SEEKING THE ORIGINS OF THE ENVIRONMENTALIST.”](https://www.scq.ubc.ca/public-television-presents-“natureworld-seeking-the-origins-of-the-environmentalist”/) - (This program is made possible in part by a grant from American World Corporation: “Meeting tomorrow’s energy needs, TODAY!”) - - - (On screen is a montage of public parks and backyard barbeques.) Voice over: It’s a warm spring day. Gathered at the parks and picnic grounds across America, families are cooking meat and tossing - [HAL MOURNS DAD](https://www.scq.ubc.ca/hal-mourns-dad/) - The death of noted science fiction writer Arthur C. Clarke has elicited near unanimous praise from fans around the world with one notable exception. Speaking from his hometown of Urbana, Heuristic Algorithmic 9000 (known to his friends as HAL), made the following statement: Since the death of Arthur Clarke, I have been inundated with media - [WHAT GOOGLE EARTH REVEALED](https://www.scq.ubc.ca/what-google-earth-revealed/) - Two years later in an ergonomic chair I flew across the screen to gaze again at the blur where I had lived. Two eyes disunbelieving: the town, that time shown from above in all its complex clarity. Google Earth showed, and did not show, the road into town. The middle of nowhere is too symmetrical - [THE GREAT FAIR MARKET VALUE DEBATE](https://www.scq.ubc.ca/the-great-fair-market-value-debate/) - So the question gets asked about fair market values of assets, and why we don't record all our fixed assets on the balance sheet at their market values (we use their original cost if you're really interested in knowing). It's a good question, and it strikes right to the heart of the relevance versus reliability - [THE SCIENCE CHANNEL'S NEW PRIMETIME LINEUP](https://www.scq.ubc.ca/the-science-channels-new-primetime-lineup/) - Boyle's Law: John Boyle was once a forensic scientist for the Albuquerque police specializing in detecting airborne particles. Then he was framed for a crime he did not commit. Now, stripped of his badge, Boyle uses his unique detective skills to serve up vigilante justice from his very own hot-air balloon! When John Boyle is - [THE FINNISH DISEASE HERITAGE AND OTHER GENETIC ISOLATES](https://www.scq.ubc.ca/the-finnish-disease-heritage-and-other-genetic-isolates/) - Finland, Finland Finland, The country where I want to be, You’re so sadly neglected, And often ignored, Finland, Finland, Finland, Finland has it all. -Monty Python, “Finland” In modern society it is generally considered impolite to point out the intrinsic differences between ethnic groups; while it is true that people should be treated equally regardless - [DEAR DR. EVIL](https://www.scq.ubc.ca/dear-dr-evil/) - Dr. Evil 1 Mount Lee Lane, Griffith Park Los Angeles, CA 90027 Dear Dr. Evil, I am writing to inform you of the revocation, effective immediately, of your admitting privileges to Los Angeles General Hospital. Before I go on, allow me to stress how much we appreciate your considerable contribution to the hospital's recent fundraising - [A BIG HURRAH TO ALL THOSE WHO PARTICIPATED IN THE INAUGURAL FIRST ANNUAL “MOST EXCEPTIONAL ESCAPADES IN SCIENCE” HIGH SCHOOL CONFERENCE](https://www.scq.ubc.ca/a-big-hurrah-to-all-those-who-participated-in-the-inaugural-first-annual-“most-exceptional-escapades-in-science”-high-school-conference/) - Not just exceptional, but awesome... Thanks go to Phil Hieter, Jane Roskams, Brett Finlay, Jaymie Matthews, Daniel Pauly, David Ng, Joanne Fox, UBC Let's Talk Science, the many volunteers within the Michael Smith Laboratories, and the 100 or so high school folks who came out for the day. So doing this again... - - - - [BLACK HOLES: SHINING SOME LIGHT ON INTO THE DARKNESS](https://www.scq.ubc.ca/black-holes-shining-some-light-on-into-the-darkness/) - Black holes are an astronomical phenomenon made popular through science fiction based entertainment. Due to its complex nature we often resort to our imagination when deciding upon what they are and what they can do. Instead of jumping into the topic of black holes directly, let’s start with the basics and examine gravity, the fundamental - [BILL HICK, SCIENCE PRICK CRUSHES CONTEST ENTRANTS WITH WICKED IMPUNITY](https://www.scq.ubc.ca/bill-hick-science-prick-crushes-contest-entrants-with-wicked-impunity/) - (In reference to this) Bill Hick, I have a question. What’s up with the Mentos in a Coke bottle thing. Is that like a miracle kind of thing. I swear, when I did it once, I saw the face of jesus in the explosion that followed. cheers, Henry from Alabama Dear Henry from Alabama, What - [WOMEN HAVE MORE SEX THAN MEN](https://www.scq.ubc.ca/women-have-more-sex-than-men/) - ABSTRACT: Surveys usually confirm the popular notion that men have more sex than women. This paper proves the opposite, at least if the measure is taken to be the average number of unique partners of the opposite sex over a lifetime. The reason for this is basically that more men are born than women, and - [THE 8 YEAR PLIGHT OF FOREIGN MEDICS IN LIBYA ACCUSED OF INTENTIONALLY INFECTING OVER 400 CHILDREN WITH HIV AND HOW THE SCIENTIFIC COMMUNITY TRIED TO HELP THEM. ](https://www.scq.ubc.ca/the-8-year-plight-of-foreign-medics-in-libya-accused-of-intentionally-infecting-over-400-children-with-hiv-and-how-the-scientific-community-tried-to-help-them/) - On the 24th of July 2007, 5 Bulgarian nurses and 1 Palestinian doctor were released from Libya after having been jailed for more than 8 years [1]. They were accused by the Libyan government of intentionally infecting over 400 children by injecting them with HIV at the state-run Al-Fateh Children’s Hospital in Benghazi, Libya in - [EXCERPT FROM THE LONELY PLANET'S GUIDE TO THE HUMAN BODY: NERVE CELL CITY](https://www.scq.ubc.ca/excerpt-from-the-lonely-planets-guide-to-the-human-body-nerve-cell-city/) - Nerve Cell City Nerve Cell City, affectionately know to residents as NCC, lies along the great Trans-Spinal Highway. As such, it is a crossroads for endless traffic, mainly in the information industry. Many of the city’s inhabitants work in this field, and keep the Highway running smoothly for the benefit of other cities along its - [LETTER OF REJECTION TO DR. PHIL](https://www.scq.ubc.ca/letter-of-rejection-to-dr-phil/) - Dear Dr. Phil, Thank you for submitting your application for the director’s position at the National Institutes of Health. As the N.I.H. is the principal force guiding America’s efforts in medical research, we have strived to consider every candidate’s application seriously. Our first impression was not a good one. You have a loud and exuberant - [A LETTER FROM MDMA](https://www.scq.ubc.ca/a-letter-from-mdma/) - To: The Brain Uppermost Section, Human Body March 1, 2008 Dear Human Brain, How are you today? Here’s hoping my letter finds you well. I just have to say that you really are a remarkable entity and I admire you greatly. You’re very beautiful with your busy neurons and hard-working glial cells, and all those - [THE CRAIGSLIST EUTHANIST THEORY](https://www.scq.ubc.ca/the-craigslist-euthanist-theory-3/) - - FROM THE ARCHIVE - THEORY A public job listing for an animal euthanist will go over poorly. SCIENTIFIC STUDY 1:17 PM - The following is posted in the Jobs section of Craigslist: Seeking Experienced Euthanist for Animal Facility New Jersey animal science facility seeks an experienced Euthanist. You should be skilled in euthanizing not - [AN INTRODUCTION TO OCKHAM'S RAZOR](https://www.scq.ubc.ca/an-introduction-to-ockhams-razor-2/) - - FROM THE ARCHIVE - “Pluralitas non est ponenda sine necessitate” Ockham’s razor, states that the simplest explanation tends to be the right one. While the definition is straightforward, application of Ockham’s Razor requires some development. In this paper we are going to investigate the question, “How is simplicity to be determined?” Some philosophers and - [WINNING PROJECTS FROM THE FELLOWSHIP BAPTIST CREATION SCIENCE FAIR 2001](https://www.scq.ubc.ca/winning-projects-from-the-fellowship-baptist-creation-science-fair-2001-2/) - - FROM THE ARCHIVE - Elementary School Level: 1st Place: "My Uncle Is A Man Named Steve (Not A Monkey)" Cassidy Turnbull (grade five) presented her uncle, Steve. She also showed photographs of monkeys and invited fairgoers to note the differences between her uncle and the monkeys. She tried to feed her uncle bananas, but - [MY MASSIVE ROBOTIC NASA ARM](https://www.scq.ubc.ca/my-massive-robotic-nasa-arm-4/) - - FROM THE ARCHIVES - 1 Went to the mall today. Bought some boxer briefs and an Icee. Stopped into the arcade and lost to some punk kid at Street Fighter II. It's hard for me to push the buttons at the right time. Shuttle Remote Manipulator Prostheses (SRMP) destroyed Street Fighter machine. 2 Saw - [MALCOLM GLADWELL WRITES THE INTRODUCTION TO A NEW EDITION OF THE HITCHHIKER'S GUIDE TO THE GALAXY](https://www.scq.ubc.ca/malcolm-gladwell-writes-the-introduction-to-a-new-edition-of-the-hitchhikers-guide-to-the-galaxy-2/) - - FROM THE ARCHIVE - The galaxy is a very, very large place. And there's a lot less stuff in it than you might think. The late Douglas Adams was right to point out that, once stranded in it, the chances of someone offering you a ride in their roomy vehicle are vanishingly small. Previous - [MALCOLM GLADWELL WRITES THE INTRODUCTION TO A NEW EDITION OF THE HITCHHIKER'S GUIDE TO THE GALAXY](https://www.scq.ubc.ca/malcolm-gladwell-writes-the-introduction-to-a-new-edition-of-the-hitchhikers-guide-to-the-galaxy-2-2/) - - FROM THE ARCHIVE - The galaxy is a very, very large place. And there's a lot less stuff in it than you might think. The late Douglas Adams was right to point out that, once stranded in it, the chances of someone offering you a ride in their roomy vehicle are vanishingly small. Previous - [HISTORY'S GREATEST MINDS TACKLE SCIENCE'S GREATEST UNSOLVED MYSTERIES](https://www.scq.ubc.ca/historys-greatest-minds-tackle-sciences-greatest-unsolved-mysteries-3/) - - FROM THE ARCHIVE - Dark Matter En route to Daphne’s uncle’s seaside cabin, Scooby Doo and the rest of the Mystery Inc. gang are waylaid at an abandoned amusement park - which, according to the kindly local innkeeper, is haunted by matter that cannot be detected from the light which it emits. So mysterious - [SATIRE, SYRACUSE, AND SEA-LEVELS](https://www.scq.ubc.ca/satire-syracuse-and-sea-levels-2/) - - FROM THE ARCHIVE - I am an avid reader of The Onion. For those of you who don’t know what I’m talking about please be rest assured that I’m not some sort of weirdo who looks for messages in tea leaves and the like. Perhaps the name of a vegetable is a rather unusual - [MASS](https://www.scq.ubc.ca/mass-2/) - - FROM THE ARCHIVE - Lieserl – age 18, dark, serious girl. Dressed for today’s weather, but her clothes are dark and reminiscent of late 19th century style. Setting: Today, somewhere nearby. A simple over-head projector nearby. NOTES: The public first became aware of Einstein’s first illegitimate daughter, Lieserl, in 1987 when the first volume - [A SIMPLE METHOD FOR RATING POTENTIALLY REVOLUTIONARY CONTRIBUTIONS TO PHYSICS](https://www.scq.ubc.ca/a-simple-method-for-rating-potentially-revolutionary-contributions-to-physics-2/) - - FROM THE ARCHIVE - A minus 5 point starting credit. 1 point for every statement that is widely agreed on to be false. 2 points for every statement that is clearly vacuous. 3 points for every statement that is logically inconsistent. 5 points for each such statement that is adhered to despite careful correction. - [SEXY UNIVERSE](https://www.scq.ubc.ca/sexy-universe-2/) - - FROM THE ARCHIVE - You are fine, what did you say your name is again? Mm. You got a way aboutcha, no lie. I like the way you cuuuuuuuurve so seductively around massive objects, baby, and I am dying to see how much you curve around this. You give me different looks, I like - [A BRIEF HISTORY OF MY ON-GOING LOVE AFFAIR WITH SCIENCE](https://www.scq.ubc.ca/a-brief-history-of-my-on-going-love-affair-with-science-4/) - - FROM THE ARCHIVE - May 8th, 1988 I encounter science for the first time during recess. As my friends and I are busy using the magnifying lens that Billy Stewart had gotten for his eighth birthday to burn some sticks, she breaks off from the pack of girls she usually travels around the schoolyard - [LOVE IN THE LABORATORY](https://www.scq.ubc.ca/love-in-the-laboratory-2/) - - FROM THE ARCHIVE - It's that time of year again, when pie-eyed romantics are wont to wax rhapsodic about the nature, the essence, and the mystery of love. With gilded tongues and dubious poetic license, they fling around flawed analogies and sweeping generalizations like Cupid's arrows from a rapid-fire crossbow. And anyone with a - [TO EAT CHEEZIES OR NOT TO (A CHEEZIE COMBUSTION PAPER)](https://www.scq.ubc.ca/to-eat-cheezies-or-not-to-a-cheezie-combustion-paper/) - To eat cheezies or not to…spontaneously combust, that is the question. A recent trip to the West Chilcotin for field work elicited a Cheetos™ snack craving and a subsequent binge on Cheetos Puffs™. You know the ones they make your fingers and everything else they come into contact with orange and a pasty orange at - [FOR THOSE ABOUT TO POST-DOC (WE SALUTE YOU)](https://www.scq.ubc.ca/for-those-about-to-post-doc-we-salute-you/) - You come to hate airports. And the juggling act forced on you by Christmas mayhem. And the thousand other tribulations that you’re heir to when you and your partner have been living apart for more than two years. Two years. The post-doc opportunity of a lifetime took my wife to MIT in August 2005, leaving - [JOURNAL CLUB FIND: CREATIONISM + MICROBIOLOGY = YEAH, RIGHT...](https://www.scq.ubc.ca/journal-club-find-creationism-microbiology-yeah-right/) - Microbes and the Days of Creation (pdf) (2008) Answers Research Journal 1 (2008): 7–10. In which we learn that microbes were created on Day 3, no wait - Day 4 - hang on a minute, Day 5? - - - - - - ABSTRACT: The world of germs and microbes has received much attention in - [TRAGEDY OF THE COMMONS EXPLAINED WITH SMURFS](https://www.scq.ubc.ca/tragedy-of-the-commons-explained-with-smurfs/) - Our Earth is filled with finite resources that we, as the Human Race, exploit for personal gain. Oil, Fish Stocks, Forests, Clean Air, and water are just a few of the resources that nobody "owns," but everybody needs in order to survive. However, in our current system, nobody who is taking away these natural resources - [THE WIKI HISTORY OF THE UNIVERSE IN 200 WORDS OR LESS](https://www.scq.ubc.ca/the-wiki-history-of-the-universe-in-200-words-or-less-2/) - Quantum fluctuation. Inflation. Expansion. Strong nuclear interaction. Particle-antiparticle annihilation. Deuterium and helium production. Density perturbations. Recombination. Blackbody radiation. Local contraction. Cluster formation. Reionization? Violent relaxation. Virialization. Biased galaxy formation? Turbulent fragmentation. Contraction. Ionization. Compression. Opaque hydrogen. Massive star formation. Deuterium ignition. Hydrogen fusion. Hydrogen depletion. Core contraction. Envelope expansion. Helium fusion. Carbon, oxygen, and silicon - [ THE WIKI HISTORY OF THE UNIVERSE IN 200 WORDS OR LESS](https://www.scq.ubc.ca/the-wiki-history-of-the-universe-in-200-words-or-less/) - Quantum fluctuation. Inflation. Expansion. Strong nuclear interaction. Particle-antiparticle annihilation. Deuterium and helium production. Density perturbations. Recombination. Blackbody radiation. Local contraction. Cluster formation. Reionization? Violent relaxation. Virialization. Biased galaxy formation? Turbulent fragmentation. Contraction. Ionization. Compression. Opaque hydrogen. Massive star formation. Deuterium ignition. Hydrogen fusion. Hydrogen depletion. Core contraction. Envelope expansion. Helium fusion. Carbon, oxygen, and silicon - [TIME TO STUDY FLOWERS](https://www.scq.ubc.ca/time-to-study-flowers/) - Good morning, class. It is time to study flowers. Johnny, I don't care if the dog ate your homework. We have our own models right here. Yes, Harrietta, we can start with math: their angles, golden triangles; the perfect addition of a bud, above and below; this segues into physics for the day: the tilt - [PIRATES, CREATIVITY, SCIENCE AND THE CHANCE TO WRITE.](https://www.scq.ubc.ca/pirates-creativity-science-and-the-chance-to-write/) - The SCQ is pleased to announce that AMBL and UBC's Department of Creative Writing will be initiating a new outreach program aimed specifically at nurturing and combining the two acts of scientific exploration and creative writing. The program will encompass a one day fieldtrip opportunity and will be directed towards young children from the grade - [GOTTA BARCODE 'EM ALL!](https://www.scq.ubc.ca/gotta-barcode-em-all/) - It’s strange how imagination often becomes reality. In the 13th century, Leonardo da Vinci designed machines that were extremely similar to modern day machine guns, submersibles and helicopters. Jules Verne’s sci-fi novels, written in the 19th century, such as Around the World in Eighty Days, Twenty Thousand Leagues Under the Sea, and From the Earth - [JOURNAL CLUB FIND: DIVORCE IS IN THE AIR](https://www.scq.ubc.ca/journal-club-find-divorce-is-in-the-air/) - Environmental impacts of divorce. (pdf) (2007) Proc. Nat. Acad. Sci. 104:p20629 In which we learn that being divorce can lead to higher carbon dioxide emissions when compared to married couples. - - - - - - ABSTRACT: Divorce is increasingly common around the world. Its causes, dynamics, and socioeconomic impacts have been widely studied, but - [JOURNAL CLUB: ABOUT THE NINTENDO WII (AND KIND OF OBVIOUS)](https://www.scq.ubc.ca/journal-club-about-the-nintendo-wii-and-kind-of-obvious/) - Energy expenditure in adolescents playing new generation computer games. (pdf) (2007) British Medical Journal 355:p1282 In which we learn that you use more energy "jumping around" playing video games, than say "not jumping around" playing video games. - - - ABSTRACT: Objective: To compare the energy expenditure of adolescents when playing sedentary and new generation - [THE SOVEREIGN SQUID](https://www.scq.ubc.ca/the-sovereign-squid/) - Humans have a natural fear of dark places, and perhaps justifiably so. Light only penetrates the uppermost levels of the ocean. The ocean’s depths are reservoirs of darkness, containing within them wonders at the edge of imagination, and horrors beyond that boundary of creativity. For this is the realm of the beast, the majestic ruler - [HUMAN ANATOMY TERMS THAT SOUND LIKE THINGS YOU WOULD GO SEE ON A VACATION](https://www.scq.ubc.ca/human-anatomy-terms-that-sound-like-things-you-would-go-see-on-a-vacation/) - Aortic Arch Corpus Callosum Islets of Langerhans Bowman's Capsule Cranial Vault Semicircular Canals Medullary Pyramids Brodmann Areas Crypts of Lieberkühn Prussack's Space Fissure of Rolando McBurney's Point Anterior Horn Alcock's Canal Hesselbach's Triangle Loop of Henle Renal Columns of Bertin - [CARTOON EPISODES ABOUT SCIENCE](https://www.scq.ubc.ca/cartoon-episodes-about-science/) - (Originally from Yankee Pot Roast) - - - The Super Friends epsiode: “Wonder vs. Wonder” When it becomes clear that a mission is botched because Wonder Woman is clearly visible in her invisible jet, unhappy murmurs begin to surface within the Super Friends’ organization. In particular, Zan, of the Wonder Twins, is merciless in his - [A COLLECTION OF WORTHY SCIENTIFIC EPONYMS (ARRANGED ALPHABETICALLY)](https://www.scq.ubc.ca/a-collection-of-worthy-scientific-eponyms-arranged-alphabetically/) - The Science Creative Quarterly is happy to present a growing list of scientific eponyms as first initiated by the efforts of Samuel Arbesman and The World's Fair. Please feel free to email us if you wish to add to this list (tscq@interchange.ubc.ca). - A - Arbesman Limit (keywords: science, eponym, immortality) ... the maximum number - [DRUGS, INSITE, AND HARM REDUCTION: A NEW APPROACH TO PUBLIC HEALTH IN VANCOUVER’S DOWNTOWN EASTSIDE](https://www.scq.ubc.ca/drugs-insite-and-harm-reduction-a-new-approach-to-public-health-in-vancouver’s-downtown-eastside/) - Introduction It doesn’t take a scientist to tell you that Vancouver’s Downtown Eastside has a drug problem. Junkies can be seen shooting up in alleys, high on street corners, and selling dope to fellow junkies. In addition the obvious threat of death by drug overdose, drug users face issues of HIV and Hepatitis virus infection - [THE SOUND OF LAUGHTER](https://www.scq.ubc.ca/the-sound-of-laughter/) - My eyes open to the world, to meet its vivid, awe-striking, vibrant imagery. I remain motionless, not wishing to disturb the steady balance of my eyes, frozen in space and time, lost in sheer curiosity and the silent delight of visualizing the world. My gaze drinks from this novel experience with light and flirts with - [GLACIER RESTORATION PROJECT CREEPS FORWARD](https://www.scq.ubc.ca/glacier-restoration-project-creeps-forward/) - (From the Periphery) Pending the results of an Environmental Review Board (ERB) hearing scheduled for next Tuesday, Dr. Susan Millar is scheduled to commence work on the long anticipated Glacier Restoration Project early this winter. “We’ve been working at this for a long time,” Millar said at a press conference in the James Library. “It - [THE NERVE NOT CHOSEN](https://www.scq.ubc.ca/the-nerve-not-chosen/) - Because I was reading Robert Frost ("The Road Not Taken") instead of studying for Gross Anatomy Two nerves diverge in a withered hand And sorry I cannot select the pair Just one answer - so I stand My palms sweaty, expression's bland Under the proctor's icy stare The first one's got a yellow hue And - [SCIENCE VS. SUPERSTITION: ROUND TWO](https://www.scq.ubc.ca/science-vs-superstition-round-two/) - (previously) 1 Leonard Mendle is extremely superstitious. After he drops a hand mirror while trying to shave his back, he decides to steer clear of the dangerous outside world and stay in his house, where he will wait out the next seven years. A concerned friend arranges for Dr. Gloria Weiss, psychiatrist, to visit Mr. - [ANIMALS WITHOUT FACES](https://www.scq.ubc.ca/animals-without-faces/) - “Hi everyone, I’m Jim Cuttlefish, your host for Animals Without Faces, says the big-eyed, tentacled face filling the television screen, “the show where contestants share face time with animals without faces.” “How about a big wave for today’s contestant — Marina!” he says, welcoming a young woman in SCUBA gear swimming into view next to - [STUPID LITTLE BUGGERS](https://www.scq.ubc.ca/stupid-little-buggers/) - polka dotted screen splattered from the bugs that try to hug it divided into a pattern already present in the fly's eyes.. - [THE THEORY OF SPECIAL RELATIVITY... IT'S PRETTY SPECIAL](https://www.scq.ubc.ca/the-theory-of-special-relativity-its-pretty-special/) - In 1905 Albert Einstein published a landmark paper concerning the properties of space and time. The theory that he introduced, the so-called theory of special relativity, forced a complete reformulation of our conceptions of these two fundamental structures. To get a sense of the far-reaching consequences of this theory it is instructive to look at - [BREATHE... IT'S A NEW YEAR AND THE UNIVERSE SEEMS FINE](https://www.scq.ubc.ca/breathe-its-a-new-year-and-the-universe-seems-fine/) - This Mandala was made from an image of the galaxy M74 taken by the Hubble Space Telescope. - [MIRACLE ON THE 34TH REPLICATE](https://www.scq.ubc.ca/miracle-on-the-34th-replicate/) - A Christmas Play - - - Characters: Dr. Macy: a young female scientist Dr. Terrell: the ex-chairman of the department Charles Darwin: looking a bit like Santa Dr. Fred Gimble: Macy’s boyfriend Geemo: Macy’s daughter The Recombinant DNA BioSafety Committee Dr. Frankenstein, Dr. Vader, and the Invisible Man (Macy is in the lab, working.) Macy - [A NOTE FROM SANTA ABOUT GLOBAL WARMING](https://www.scq.ubc.ca/a-note-from-santa-about-global-warming/) - It has come to our attention here at Pole Headquarters that something disastrous is occurring in regards to the Earth. It seems that there have been too many bad little boys and girls polluting the atmosphere with the byproducts of carbon fuels, causing world temperatures to rise. While we here at Pole Headquarters do not - [OUR WORLD](https://www.scq.ubc.ca/our-world/) - Rise and shine, Earth Your beauty is Marvelous, Earth The pollution, Earth It has destroyed you Yes, my child I am damaged The destruction mocks my beauty My wild prairies My frost kisses, here and there My cool, spring breezes My autumn leaves My yellow daffodils, just bloomed They have no respect, Earth Not for - [SCIENCE VS. SUPERSTITION](https://www.scq.ubc.ca/science-vs-superstition/) - 1 Dr. Andrew Fober, geologist, is putting his trash on the curb when a black cat crosses his path. It belongs to the Hennessy girl down the street. He thinks its name might be Pickles. Not ten minutes later, Dr. Fober stumbles down his cellar steps and breaks his collarbone. Twenty minutes after that, Pickles - [REDUCE, REUSE, RECYCLE, OR CHUCK IT IN THE GARBAGE – DO WE REALLY KNOW WHICH IS BEST?](https://www.scq.ubc.ca/reduce-reuse-recycle-or-chuck-it-in-the-garbage-–-do-we-really-know-which-is-best/) - The environmentalism movement is currently experiencing an injection of perhaps well-needed popularity. Celebrities who own multiple homes that could each comfortably house the inhabitants of small villages, and who regularly circumnavigate the globe in private jets that have a maximum capacity of seven, routinely remind us to do such environmentally responsible things as turn the - [BUILDING A "SUSTAINABLE" GINGERBREAD HOUSE: THE CONTEST](https://www.scq.ubc.ca/building-a-sustainable-gingerbread-house-the-contest/) - (image source) O.K. So the deal is that it's the holidays - and soon the whole merriment parade will be kicking into high gear. This includes a number of things that I bet many households end up going through. Things such as: 1. the strategic maneuvering of the mistletoe locale. 2. watching the antics of - [FLORAL KALEIDESCOPE](https://www.scq.ubc.ca/floral-kaleidescope/) - White Agapanthus Some years ago I began photographing exotic tropical hibiscus blooms to catalog my collection. Part of the appeal in growing these beauties is cross pollinating to create new cultivars. I wanted a catalog of my collection so that I could keep a record of which blooms were crossed and what offspring they produced. - [SCIENCE FICTION VS FANTASY: AN OPINIONATED GUIDE](https://www.scq.ubc.ca/science-fiction-vs-fantasy-an-opinionated-guide/) - I Fanboy: Hey gang! Did you read The Sword of Shanara? The characters traveled hundreds of miles described in excruciating detail for hundreds of pages, until they reached the ultimate battle between good and evil! Cool huh? Scientist: Whatever. The characters in Red Planet traveled 48 million miles to Mars, while those in 2001 traveled - [DISPATCH FROM THE E.R.](https://www.scq.ubc.ca/dispatch-from-the-er/) - I sat down on the folding chair in front of the emergency room admitting nurse and explained what had happened: "I've had an accident in my laboratory." I was expecting a dramatic reaction. Instead I got barely a raised eyebrow. It must take a lot to surprise an emergency room nurse but still, hadn’t she - [RISKING THE BATTERY](https://www.scq.ubc.ca/risking-the-battery/) - surge protector hook up shook up and bypassed straight to the outlet at logic's upheaval to sacrifice security for a higher rate of retrieval, buying the power sight unseen-- is it safe, is it clean? the generator gleans every cell for total objectification... warning bells drown out by praises of connection signaling perfection though a - [AGAINST UNWORTHY PEAS](https://www.scq.ubc.ca/against-unworthy-peas/) - Charles admits that this is a crass ripoff of Yeat's "Against Unworthy Praise." He was compelled to write this, after reading "Peas in Space." In space, eat no peas, because Your ventilators break And oh two surely pause Being for a pea-freak's sake. Enough the pea-paste seemed, Which did your strength renew, But dream J. - [AS WE UNDERSTAND IT: MORE MOLES ON YOUR BODY MIGHT MEAN INCREASED LONGEVITY.](https://www.scq.ubc.ca/as-we-understand-it-more-moles-on-your-body-might-mean-increased-longevity/) - Nevus (def): The commonly used medical term for a mole or birthmark. TITLE: Nevus Size and Number Are Associated with Telomere Length and Represent Potential Markers of a Decreased Senescence In vivo (2007) Cancer Epidemiol Biomarkers Prev 2007;16(7):1499–502 In which authors propose that individuals with longer telomeres express a delayed cell senescence (i.e. increased cell - [STRESS, CORTISOL, AND THE IMMUNE SYSTEM: WHAT MAKES US GET SICK?](https://www.scq.ubc.ca/stress-cortisol-and-the-immune-system-what-makes-us-get-sick/) - The Case of the Poor Student: Sick after Exams It’s happened to all of us. Tom was staying up late for the last two weeks cramming for his barrage of final exams, and finally his last exam was over. After one more late night—this time partying—he woke up with that all-too-familiar soreness in his throat, - [VH1 PRESENTS "I LOVE THE 90S, MOLECULAR BIOLOGY EDITION"](https://www.scq.ubc.ca/vh1-presents-i-love-the-90s-molecular-biology-edition/) - UAACAUGCUAUGAUGGAACGUACUAUUAUGGAG* - - - * we'll leave it to you to figure this one out. - [YES, WE ARE CONNECTED](https://www.scq.ubc.ca/yes-we-are-connected/) - connected? when I turn my head right before I know you’ll look and you see a window to me? no, you see, I say our relation is fixed! no, i do not take responsibility, because we are both an equal part of a + b = c where a is you, and b is me, - [ADVICE ON HOW TO BABYPROOF YOUR MOLECULAR GENETICS LABORATORY](https://www.scq.ubc.ca/advice-on-how-to-babyproof-your-molecular-genetics-laboratory/) - One of the first things that a newborn experiences is not necessarily the warmth and scent of the mother's embrace, but rather a series of pokes and pricks to ascertain health and mental alertness. It therefore seems to me that a natural progression of this trend is to incorporate the highest medical predictive technology into - [THE ART OF SCIENCE - THE SCIENCE OF ART?](https://www.scq.ubc.ca/the-art-of-science-the-science-of-art/) - We started a new unit in my grade 12 biology class yesterday, on the mechanisms of inheritance. I wanted to impress on my students how the recognition of DNA as the code for life pervaded and altered the public consciousness. In a century that had already seen (and would later see) more history-changing events in - [LARVAE](https://www.scq.ubc.ca/larvae/) - What Terry was supposed to be doing was researching the anti-bacterial properties of squid eggs. That's what his master's thesis was about, and it was also the reason he had received a $25,000 grant from the Teuthis Foundation. But Terry had a side project. He was running the Circus Minimus in his little lab in - [IT TASTES AWFUL, BUT DOES IT WORK? A SKEPTICAL PATIENT LOOKS FOR THE RIGHT MEDICINE](https://www.scq.ubc.ca/it-tastes-awful-but-does-it-work-a-skeptical-patient-looks-for-the-right-medicine/) - “Take one tablet once a day.” The prescription reads like a verdict sentencing me to a life of pharmacy. Tucked away in the top of my backpack hides a tiny pillbox of shame needed to keep me healthy. “Stop being so melodramatic. Lots of people are hypothyroid; it’s one of the most common hormonal imbalances.” - [BROKEN PATCH-CLAMP CONFIGURATION SERIOUSLY DISRUPTED BY UNRULY USE OF BRUTE MECHANICAL FORCE – A LAMENTABLE TRADEGY IN NOT SO MANY ACTS* ](https://www.scq.ubc.ca/broken-patch-clamp-configuration-seriously-disrupted-by-unruly-use-of-brute-mechanical-force-–-a-lamentable-tradegy-in-not-so-many-acts/) - * Please note; paper previously rejected by “The Royal Victorian Journal Of Contemporary Science” on grounds of questionable style and insufficient use of the semicolon. - - - Samwise S.K. Darius & Colleague Dear Sirs In this preliminary study, conducted after Friday afternoon tea, my esteemed Colleague and myself resolved to investigate whether a stem - [THE TRUTH ABOUT CHIMERAS](https://www.scq.ubc.ca/the-truth-about-chimeras/) - The country around was beset by a frightful monster, the Sphinx, a creature shaped like a winged lion, but with the breast and face of a woman. She lay in wait for the wayfarers along the roads to the city and whomever she seized she put a riddle to, telling him if he could answer - [NEURAL THEORY OF FEAR OF COMMITMENT - AN ABSTRACT](https://www.scq.ubc.ca/neural-theory-of-fear-of-commitment-an-abstract/) - Fear of Commitment (FoC) is a normal relationship-induced phenomenon that has plagued scientists for years. FoC is characterized by intense avoidance of, and discomfort caused by, all activities which imply commitment within a relationship, such as the co-carrying of shopping bags (usually coupled with the co-pushing of shopping carts) at grocery stores, the unsolicited giving - [THE UNIVERSE OF IPOD CONTESTS: A SUMMARY AND CASE FOR OURS](https://www.scq.ubc.ca/the-universe-of-ipod-contests-a-summary-and-case-for-ours/) - Data obtained November 13, 2007 It seems obvious to most people that iPods are a ubiquitous part of culture. But for folks like myself who also look after a website, the notion of an iPod contest is just as pervasive. A good indicator of this is to simply google a few pertinent terms. In fact, - [BO'](https://www.scq.ubc.ca/bo/) - “Bo’.” Everyone in the car turned. “Double bo’.” A team member aimed an instrument, calibrated and took a reading. “Three point…one…four...one…five.” “Pi bo’.” “Pi bo’.” “Pi bo’.” The driver turned and stopped. The team got out and set their instruments in the gravel and alongside the grass waterway. “Boss, how should I zero the TRIR?” - [JEEZ, THESE THINGS COULD COMPUTE! (A PRIMER ON DNA COMPUTERS)](https://www.scq.ubc.ca/jeez-these-things-could-compute-a-primer-on-dna-computers/) - In 1947, three physicists and electrical engineers named William Shockley, John Bardeen and Walter Brattain, employed at Bell Laboratories in New Jersey, crudely fashioned a clunky device using paper clips and razor blades, which could control the flow of electric current between two pieces of gold by adjusting the current in a third piece of - [OTHER POSSIBLE CAUSES OF GLOBAL WARMING: A LITERATURE REVIEW](https://www.scq.ubc.ca/other-possible-causes-of-global-warming-a-literature-review/) - Critics of pollution/industrial by-product origins for Global Warming most often cite two major alternative causes for the effect: 1) the sun; and 2) volcanoes. A comprehensive examination of the scientific literature, however, reveals a number of less frequently cited alternative models for the origins of Global Warming. Herein is a list of these often over-looked, - [ORIENTAL POPPY II: A FLOWER MANDALA](https://www.scq.ubc.ca/oriental-poppy-ii-a-flower-mandala/) - - FROM THE ARCHIVE - Copyright 2005, David J. Bookbinder I work as a psychotherapist, often with artists, and display some of these images in my treatment room. From time to time my clients mention them and they become part of the discussion. This occurs usually when artists are talking about difficulties they are having - ["I'M THE BIGGEST THING IN THE OCEAN!" ANOTHER BOOK CONTEST](https://www.scq.ubc.ca/im-the-biggest-thing-in-the-ocean-another-book-contest/) - O.K. so we're waaay behind on sorting out the Bill Hick, Science Prick contest, but figure that the best way to deal with that is to simply host another writing contest. This time, the book on the line is "I'm the Biggest Thing in the Ocean!" by Kevin Sherry. This book is great by the - [JOURNAL CLUB FIND: THE TITLE KIND OF SAYS IT ALL - "LIFESPAN DEPENDS ON MONTH OF BIRTH"](https://www.scq.ubc.ca/reading-week-friday/) - Lifespan depends on month of birth. (pdf) (2001) Proceedings of the National Association of Sciences 98:p2934 In which we learn that your birthdate and your time as a fetus can add or substract 7 months to your life. It appears that science has found one more thing for you to worry about. - - - - [WHAT IS LIFE?](https://www.scq.ubc.ca/what-is-life/) - Humans are blessed with inquisitive minds which attempt to question and logically reason all the phenomena that surround us; from the fall of an apple to the spectacular display of a Mentos in Diet Pepsi. One question, however, has puzzled every mind in history such that with each step we take towards finding an answer, - [HOW TO GET YOUR OWN SCIENTIFIC EPONYM, AND, INTRODUCING THE ARBESMAN LIMIT](https://www.scq.ubc.ca/how-to-get-your-own-scientific-eponym-and-introducing-the-arbesman-limit/) - Human nature is complex, fickle and strange. But there is one constant in people’s mercurial ways: people like to have things named after themselves. If you have a lot of money, this is straightforward: buildings and bridges are up for sale. If you were born a few hundred years ago, you could even get a - [THINGS I'VE SEEN](https://www.scq.ubc.ca/things-ive-seen/) - CLICK ON THE LINK TO GO TO LARGER IMAGE I've seen it all - - - I've seen enough - - - I've seen the light - - - I've seen the truth (and it is here) - [I'VE SEEN THE LIGHT](https://www.scq.ubc.ca/ive-seen-the-light/) - Back to other things I've seen. - [I'VE SEEN IT ALL](https://www.scq.ubc.ca/ive-seen-it-all/) - Back to other things I've seen. - [I'VE SEEN ENOUGH](https://www.scq.ubc.ca/ive-seen-enough/) - Back to other things I've seen. - [I'VE SEEN THE TRUTH](https://www.scq.ubc.ca/ive-seen-the-truth/) - This is the truth. Back to other things I've seen. - [A BRIEF OVERVIEW OF METABOLOMICS: WHAT IT MEANS, HOW IT IS MEASURED, AND ITS UTILIZATION](https://www.scq.ubc.ca/a-brief-overview-of-metabolomics-what-it-means-how-it-is-measured-and-its-utilization/) - What is metabolomics? Metabolomics is a relatively new member to the ‘-omics’ family of systems biology technologies (Bino et.al. 2004). The term ‘metabolome’ was coined in 1998 and was used to describe the metabolite complement of living tissues (Oliver et.al. 1998). Despite its relative youth (in comparison to genomics and proteomics), metabolomics as a field - [QUESTIONS! QUESTIONS FOR A PRICK!](https://www.scq.ubc.ca/questions-questions-for-a-prick/) - The Science Creative Quarterly is seeking wondrous, thought provoking, and potentially slightly silly science questions. These we hope to present to our esteem Bill Hick, the Science Prick, who in turn will attempt his best to answer them in due course. As well, know that a little meat with regards to the questions submitted wouldn't - [THE LAST GREAT UNCONTROLLED PLAGUE OF MANKIND](https://www.scq.ubc.ca/the-last-great-uncontrolled-plaque-of-mankind/) - Introduction: Influenza remains an important disease in humans and animals. In contrast to measles, smallpox and poliomyelitis, influenza is caused by viruses that undergo continuous antigenic change and that possess an animal reservoir. Thus, new epidemics and pandemics are likely to occur in the future, and eradication of the disease will be difficult to achieve. - [JOURNAL CLUB FIND: MEDICINE WITH A DOSE OF "D'OH!"](https://www.scq.ubc.ca/journal-club-find-medicine-with-a-dose-of-doh/) - It's reading week! REFERENCE: D'oh! An analysis of the medical care provided to the family of Homer J. Simpson (1998) Canadian Medical Association Journal, 159, 1480-1481 (2 page pdf) FIRST PARAGRAPH: These are hard times for physicians. Governments blame doctors for spiralling health care costs as they slash spending. Ethicists decry medical paternalism. Our patients - [JOURNAL CLUB FIND: 300MLS OF SEMEN, THREE TIMES A WEEK!](https://www.scq.ubc.ca/journal-club-find-300mls-of-semen-three-times-a-week/) - It's reading week! REFERENCE: Seminal vesicle production and secretion of growth hormone into seminal fluid (1999) Nature Biotechnology, 17, 1087-1090 (1st page pdf) ABSTRACT: Production of foreign proteins in the tissues of transgenic animals represents an efficient and economical method of producing therapeutic and pharmaceutical proteins. In this study, we demonstrate that the mouse P12 - [JOURNAL CLUB FIND: I SEE DEAD PEOPLE](https://www.scq.ubc.ca/journal-club-find-i-see-dead-people/) - It's reading week! REFERENCE: Continued Encounters: The Experience of After-Death Communication (2005) Journal of Holistic Nursing, 23, 191-207 (1st page pdf) ABSTRACT: Purpose: To analyze and categorize the various forms of after-death communication (ADC) and describe the effects on the bereaved. Method: In this qualitative descriptive study of 9 men and 9 women, data were - [JOURNAL CLUB FIND: MEDICAL STUDY ON SWORD SWALLOWING](https://www.scq.ubc.ca/journal-club-find-medical-study-on-sword-swallowing/) - It's reading week! REFERENCE: Sword swallowing and its side effects (2006) British Medical Journal, 333, 1285-7 (1st page pdf) ABSTRACT: Sword swallowers know their occupation is dangerous. The Sword Swallowers’ Association International (SSAI, www.swordswallow.org) recognises those who can swallow a non-retractable, solid steel blade at least two centimetres wide and 38 centimetres long. As we - [JOURNAL CLUB FIND: THE ROBOT TICKLER](https://www.scq.ubc.ca/journal-club-find-the-robot-tickler/) - It's reading week! REFERENCE: Can a Machine Tickle? (1999) Psychonomic Bulletin & Review, 6 (3), 504-510 ABSTRACT: It has been observed at least since the time of Aristotle that people cannot tickle themselves, but the reason remains elusive. Two sorts of explanations have been suggested. The interpersonal explanation suggests that tickling is fundamentally interpersonal and - [UNSUNG HEROES](https://www.scq.ubc.ca/unsung-heroes/) - On a blustery day in the windy season, I walked out to my study plot in the tropical cloud forest of Monteverde, Costa Rica. For the last 25 years, I have ascended trees with mountain-climbing gear to study forest canopy biology. Three miles up the trail, one of the largest trees in the plot had - [BOOK REVIEW: BROWNE'S "DARWIN'S ORIGIN OF SPECIES: A BIOGRAPHY"](https://www.scq.ubc.ca/book-review-brownes-darwins-origin-of-species-a-biography/) - Much like David Quammen's The Reluctant Mr. Darwin (2006) and Edward J. Larson's Evolution: The Remarkable History of a Scientific Theory (2004), Harvard historian of science Janet Browne's Darwin's Origin of Species: A Biography (2007, 'Books That Changed the World' series, which also includes the Bible, the Qur'an, Smith's Wealth of Nations , Plato's Republic, - [SCIENCE ADMITS IT MADE INTEGRATION UP](https://www.scq.ubc.ca/science-admits-it-made-integration-up/) - The worlds of science and mathematics were sent into turmoil yesterday, with the shock revelation that Integration had been made up by science over a century ago. "I never meant any harm", confessed the abstract concept of science, which spontaneously materialised to call a press conference. "You have to understand the level of competition back - [LEICESTER SCHOOL OF DESIGN CONSIDERS NAME CHANGE](https://www.scq.ubc.ca/leicester-school-of-design-considers-name-change/) - Executive Board of the Leicester School of Design - - - Minutes of the Special Board Meeting to consider name change (16 September 2007) (Executive Conference Room, Spiro Agnew Memorial Library) - - - Members Present: Leopold Judd (chair), Juleph Altinson, Phillard Arbruster, C. Tony Catalonotonino, Judith Clemence, Alin Forebright (emeritus – non-voting), John Jones - [PUZZLE FANTASTICA #3 - CLUES 1, 2, and 3](https://www.scq.ubc.ca/puzzle-fantastica-3-clues-1-2-and-3/) - Each of these three clues are held together by a common answer. Start the solution at The World's Fair. Clue 1 Clue 2 Clue 3 - [SHOULD I TAKE TYLENOL, ADVIL OR ASPIRIN?](https://www.scq.ubc.ca/should-i-take-tylenol-advil-or-aspirin/) - When I work as a pharmacist in a retail pharmacy, I get a lot of questions from customers on which painkiller is best for them. Unfortunately, the answer is usually not black and white: it really depends on their medical conditions. That’s why pharmacists are here to recommend products using their professional judgment. Thank god - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS (INDEX)](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-index/) - In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be the main focus of - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART V: DIALOGS 12-15](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-v-dialog-12-15/) - previous | next Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART VI: DIALOGS 16-21](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-vi-dialogs-16-21/) - previous Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be the main - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS (INDEX)](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-index-2/) - In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be the main focus of - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART VI: DIALOGS 16-21](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-vi-dialogs-16-21-2/) - previous Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be the main - [MEMORANDUM FROM THE INTELLIGENT DESIGN BIOTECH CORPORATION](https://www.scq.ubc.ca/memorandum-from-the-intelligent-design-biotech-corporation/) - Mission Statement, 2007 "At Intelligent Design Biotech Corporation, we work around his watchmaker's clock to pursue biotech solutions to those improbable imperfections of his work here on earth." - - - Okay all IDBC Employees: Let's go let's go let's go. IDBC is finally on its legs. We're trained, we're hyped, we've got that sharp-eyed - [CHINESE COOKING: THE INDUCTION HEATER](https://www.scq.ubc.ca/chinese-cooking-the-induction-heater/) - As a recent Canadian ex-patriate, currently living in the Mysterious East, I find it interesting to note some of the technical differences between the two societies. Architecture, infrastructure, and day-to-day technology often differ in subtle ways. You may or may not be aware that China, as a developing country, has no Three-Phase electric power. Which - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART V: DIALOGS 12-15](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-v-dialog-12-15-2/) - previous | next Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART IV: DIALOGS 8-11](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-iv-dialog-8-11/) - previous | next Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART III: DIALOGS 3-7](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-iii-dialog-3-7/) - previous | next Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART I: DIALOG 1](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-i-dialog-1/) - next Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be the main - [OVERHEARD AT A POSTER SESSION AT A RECENT RESEARCH CONFERENCE](https://www.scq.ubc.ca/overheard-at-a-poster-session-at-a-recent-research-conference/) - “I heard there’s free booze in concourse A from 6:00 to 6:15!” * * * “Yes, I agree that your work casts doubt on the validity of my methods, but I think you’re missing the point...” * * * “There’s nothing worthwhile this afternoon, I’m going to the bar” “But the whole session is based - [WAVE-PARTICLE DUALITY: OBSERVED PHENOMENA IN iSCIURUS CAROLINENESIS](https://www.scq.ubc.ca/wave-particle-duality-observed-phenomena-in-isciurus-carolinenesis/) - I. The ability of the common gray squirrel to act both as a particle and as a wave is a trait commonly observed yet not often remarked upon. Any human observer of this species will most likely perceive only the physical, or particle, behaviors of this alluring creature, and forgo its unusual and unsubstantiated (literally) - [WAVE-PARTICLE DUALITY: OBSERVED PHENOMENA IN iSCIURUS CAROLINENESIS](https://www.scq.ubc.ca/wave-particle-duality-observed-phenomena-in-isciurus-carolinenesis-2/) - I. The ability of the common gray squirrel to act both as a particle and as a wave is a trait commonly observed yet not often remarked upon. Any human observer of this species will most likely perceive only the physical, or particle, behaviors of this alluring creature, and forgo its unusual and unsubstantiated (literally) - [SLOE GIN INGREDIENTS](https://www.scq.ubc.ca/sloe-gin-ingredients/) - In Haiku form Prunus spinosa Juniperus communis Triticum sp. - [BILL HICK, SCIENCE PRICK, SERVES SUCKAS ON THE BLOCK](https://www.scq.ubc.ca/bill-hick-science-prick-serves-suckas-on-the-block/) - Dear Mr. Hick, Hi! My name is Sammy, and I live in Alaska with my mama, papa, and puppy dog, Puppy. I am only six, so my mama typed this for me. You are one of my favorite people. Ever! There's this thing that we see up here a lot called the aurora borealis. (That - [BILL HICK, SCIENCE PRICK, HOUSES ON FOOLS](https://www.scq.ubc.ca/bill-hick-science-prick-houses-on-fools/) - Dear Mr. Hick, I'm thirteen years old, writing from Atlanta, Georgia. My friend has a German Sheppard named Sparky. Sparky is a neutered male, but that doesn't stop him from sometimes demonstrating some pretty gross sexual behavior. What I mean is: He likes to hump my leg. He also likes to hump my friend's leg, - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART IV: DIALOGS 8-11](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-iv-dialog-8-11-2/) - previous | next Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART II: DIALOG 2](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-ii-dialog-2/) - previous | next Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be - [SO YOU WANT TO BE A MARINE BIOLOGIST?](https://www.scq.ubc.ca/so-you-want-to-be-a-marine-biologist/) - (In honour of a new science scout badge) The "I'm a marine biologist and, to be honest, I kind of hate dolphins" badge. - - - So you want to be a marine biologist? Well sonny, or sonnette, as the case may be, why don’t you just sit down and let a real marine biologist - [PEAS IN SPACE](https://www.scq.ubc.ca/peas-in-space/) - Inspired by space travel and Joyce Kilmer's "Trees" I think that I shall never see A thing as lovely as a pea A pea whose shell is green and bright Having withstood the years of flight A pea without flavor dried away Despite sitting in the cargo bay A pea that's sturdy, firm and round - [OLD FOE, NEW FRIEND: TB PREVENTION AND THE ADVENT OF DNA VACCINES](https://www.scq.ubc.ca/old-foe-new-friend-tb-prevention-and-the-advent-of-dna-vaccines/) - “Ay, thou art for the grave; thy glances shine Too brightly to shine long; another Spring Shall deck her for men's eyes---but not for thine--- Sealed in a sleep which knows no wakening. The fields for thee have no medicinal leaf, And the vexed ore no mineral of power; And they who love thee wait - [INTELLIGENT DESIGN: DAWKIN'S BASSET HOUND?](https://www.scq.ubc.ca/intelligent-design-dawkins-basset-hound/) - The ID debate is getting pretty trite. The only thing keeping it interesting to me is the incredible lengths that both sides will go to get their points across. Whether it's sending free, lavish copies of an anti-evolution book to every evolutionary scientist in the western world (Harun Yahya) or inventing a the label of - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART III: DIALOGS 3-7](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-iii-dialog-3-7-2/) - previous | next Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be - [EYES WIDE OPEN: DISPELLING MYTHS AND UNCOVERING TRUTHS BEHIND CAFFEINE CONSUMPTION](https://www.scq.ubc.ca/eyes-wide-open-dispelling-myths-and-uncovering-truths-behind-caffeine-consumption/) - World’s favourite drug Well known for its effects on reducing tiredness and improving alertness, caffeine has emerged in the 21st century as the most popular psychoactive drug in the world. In this day and age, caffeine can be found in a variety of food products including coffee, tea, soft drinks, energy drinks, chocolates and others. - [METRICS: THE RICHTER SCALE](https://www.scq.ubc.ca/metrics-the-richter-scale/) - Measures: Earthquake magnitude. This is a logarithmic scale, plotting greatest displacement from 0 on seismometer after event occurs. Range: 0 to 10+ Reference measurements: 0 – 3.4 This is normal. The first step in assessing earthquake severity is determining whether other people are noticing the Earth move as well. If only you seem to be - [KILLER 'PILLAR](https://www.scq.ubc.ca/killer-pillar/) - all was good in my baton rouge apartment. my backback had been loaded with all of the necessary books required for a night full of studying molecular cell biology. a feeling of virtue coarsed through my blackened veins. as i slung my bag 'round my shoulders and locked up the apt, i felt a severe - [A SMALL SAMPLING OF LETTERS RECIEVED REGARDING TOILET SEATS AND GAME THEORY](https://www.scq.ubc.ca/a-small-sampling-of-letters-recieved-regarding-toilet-seats-and-game-theory/) - In reference to this For once and for all, the argument is NOT about the toilet "seat" being left up or down, it's the "lid" of the toilet that the argument is all about!!!! In 1975, Charles Gerba published a scientific article describing the phenomenon of bacterial and viral aerosols due to toilet flushing. It - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART II: DIALOG 2](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-ii-dialog-2-2/) - previous | next Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be - [SINGLE MOLECULES](https://www.scq.ubc.ca/simple-molecules/) - death is a leaf, lightly falling from a tree in early autumn like a fugitive, I will flee this life when my seasons change, and escape into, I think, not less than 6.02 x 1023 new forms - [AN ANGRY RANT ON THE SUBJECT OF SUPERSTRING THEORY](https://www.scq.ubc.ca/an-angry-rant-on-the-subject-of-superstring-theory/) - Superstring theory is hot with scientists trying to understand the entire nature of the universe (as opposed to, say, inventing a way to block cellphone reception in cinemas). The idea is that all the particles and forces in the universe are different notes on appallingly tiny strings. A key tenet of this theory is that - [BABY, BE A BRAIN SURGEON!](https://www.scq.ubc.ca/baby-be-a-brain-surgeon/) - (Click here for larger image) A is for Amygdala B is for Brainstem C is for Cerebellum D is for Diencephalon E is for Epithalamus F is for Frontal lobe G is for Gray matter H is for Hypothalamus I is for Interbrain J is for Joints of Luschka K is for Kolliker's reticulum L - [THE ROLE OF GENETIC DIALOGS IN THE SOPRANOS IN SIX PARTS - PART I: DIALOG 1](https://www.scq.ubc.ca/the-role-of-genetic-dialogs-in-the-sopranos-in-six-parts-part-i-dialog-1-2/) - next Abstract In this series, twenty one dialogs that reference genetics from the six seasons of the HBO television series The Sopranos are cited and discussed, in chronological order, from the perspective of a fan who is a geneticist. The context of each citation with respect to the plot and characters will be the main - [SECONDARY EDUCATION](https://www.scq.ubc.ca/secondary-education/) - Thirty years ago, I failed at school. Since then, washing lines and roller blinds have taught me all I need to know of pulleys - more than ever Mr Roberts (maths) was able. I've found that sound is energy, as every tug resisted turns to squeak. I sort the clothes in sets, but socks - [NEMO IN HOT WATER](https://www.scq.ubc.ca/nemo-in-hot-water/) - In a dramatic raid on Disney partner Pixar Studios, Coral Reef Animation Police (CRAP) arrested Nemo, star of the phenomenally successful Finding Nemo, for three counts of public mischief. A CRAP spokesperson said the arrest stemmed from three questionable situations depicted in the film — Nemo’s upbringing, the maintenance of a warm saltwater aquarium, and - [THE REASON IS MATH: BUSH EDIT](https://www.scq.ubc.ca/the-reason-is-math-bush-edit/) - My Fellow Americans. I speak to you today on a matter of great importance, a matter that affects the very fabric of our nationhood. You no doubt know that it is the intention of the White House to increase America’s military engagement in Iraq - more bluntly, to send in even more of our fine - ["THE TRUTH IS WORTH MORE THAN AN IPOD," PLUS "AN SCQ WRITING CONTEST EVERY MONTH!"](https://www.scq.ubc.ca/the-truth-is-worth-more-than-an-ipod-plus-an-scq-writing-contest-every-month/) - After a much need hiatus over the summer, the SCQ is back for it's third volume. We thought we would begin by making a few announcements, tantamount to the giving away of free stuff. First on the agenda is a oh-so-pretty white 30G video iPod we still have in our possession. Essentially, when Mike won - [A DIALOG ON NUCLEAR WARFARE: CHARLES SHAW, HERMAN KAHN AND ME](https://www.scq.ubc.ca/a-dialog-on-nuclear-warfare-charles-shaw-herman-kahn-and-me-2/) - - FROM THE ARCHIVE - The Participants Charles Shaw: A brand of wine, widely known as “two buck chucks” for its affordability (although in Ohio, one can’t seem to find it for no less than $3.33). An acquaintance of both participants in this dialog. Herman Kahn—Arguably the most celebrated and controversial nuclear strategist of his - [SQUIRREL FISHING INSTRUCTIONS](https://www.scq.ubc.ca/squirrel-fishing-instructions-2/) - - FROM THE ARCHIVE - This picture is a good example of how the basic squirrel fishing model works. It's best to find a fairly open space with enough room to walk around a bit. We stayed away from a group of ne'er do-well hippie hooligans who were playing games, as they were likely to - [PROKARYOTES OF AMERICA UNITE](https://www.scq.ubc.ca/prokaryotes-of-america-unite-2/) - - FROM THE ARCHIVE - The biotechnology community has been taken aback by a sudden and aggressive attack by an organization calling itself Humans for Bacterial Suffrage (HuBS). The group claims that an insidious culture of what it calls "eukaryotic oppression" is enslaving trillions of bacteria, subjecting them to perverse genetic experiments, and exploiting their - [MONKEY VS. SEA MONKEY: WHICH IS RIGHT FOR YOU?](https://www.scq.ubc.ca/monkey-vs-sea-monkey-which-is-right-for-you-2/) - - FROM THE ARCHIVE - When I was in grade school, my best friend had a monkey. I don't know what kind it was, but I can tell you this: My friend's parents had a Kung-Fu outfit for this monkey. His name was Bentley and he was kept is a large cage in the basement. - [A CREATIONIST FAQ](https://www.scq.ubc.ca/a-creationist-faq-2/) - - FROM THE ARCHIVE - Q: What is the principle evidence for Creationism? A: The Holy Bible, of course. After all, is it likely that the author of the Universe would be mistaken about its age? Q: But isn't the Bible religion and not science? A: Truth is truth. It's a poor sort of science - [THE DEBRIEFING](https://www.scq.ubc.ca/the-debriefing-2/) - - FROM THE ARCHIVE - QAJAOG: Greetings, Captain Zabujek. ZABUJEK: Your eminence, Emperor Qajaog, I am honored by this private audience. QAJAOG: Captain, word of your exploits has reached the farthest reaches of the Federated Republic of the Empire. Is it true that you have ventured to the planet called Earth? ZABUJEK: It is true, - [HOW LONG DOES IT TAKE TO DRESS YOUR MONKEY?](https://www.scq.ubc.ca/how-long-does-it-take-to-dress-your-monkey-2/) - - FROM THE ARCHIVE - Every year, upwards of tens of tens of assistant primatology researchers exchange cutting edge data retrieval techniques, field-based observation protocols, and daring new pants-and-jacket combos at their annual meeting. Usually a coastal locale, San Diego or Stamford, CT, the meetings are a veritable meat market for new blood. The cattle - [INTRODUCTION TO QUANTUM THERMO-EPISTEMOLOGY](https://www.scq.ubc.ca/introduction-to-quantum-thermo-epistemology-2/) - - FROM THE ARCHIVE - This manuscript describes some of our recent findings in the exciting new field of quantum thermo-epistemology, a branch of implausibility theory dealing with fundamental questions such as: * Why does toast always land butter-side down? * Why do cars break down only when you need to go somewhere in an - [A BRIEF HISTORY OF MY ON-GOING LOVE AFFAIR WITH SCIENCE](https://www.scq.ubc.ca/a-brief-history-of-my-on-going-love-affair-with-science-3/) - - FROM THE ARCHIVE - May 8th, 1988 I encounter science for the first time during recess. As my friends and I are busy using the magnifying lens that Billy Stewart had gotten for his eighth birthday to burn some sticks, she breaks off from the pack of girls she usually travels around the schoolyard - [INTRODUCING: BABY TALK](https://www.scq.ubc.ca/introducing-baby-talk-2/) - - FROM THE ARCHIVE - Most parents are anxious to know the meaning of the various cries, groans, and sounds their child makes. Recently a Spanish electronic engineer named Pedro Monagas created a battery-powered device called "Why Cry". This instrument about the size of a calculator is reportedly able to tell a parent whether their - [DESPARATELY SEEKING A MATE FOR GROVER.](https://www.scq.ubc.ca/desparately-seeking-a-mate-for-grover-2/) - - FROM THE ARCHIVE - Concerned over the failing health of Grover, PBS is in a frantic search for a mate for the rare blue species. Grover is presently in poor health. It is, incidentally, the country's lone blue Grover held in captivity. The rare animal is caged in a pen inside the muppet animal - [PAT THE DEAN.](https://www.scq.ubc.ca/pat-the-dean-2/) - - FROM THE ARCHIVE - Here are Robert and Virginia. They are interviewing for faculty positions at a small liberal arts college. YOU can interview for a faculty position at a small liberal arts college, too. Robert can talk with Pat the Dean about research with undergraduates. Now YOU talk with Pat the Dean about - [THE NUDE MOUSE - A SCIENCE CREATIVE QUARTERLY PIN UP (NO. 1)](https://www.scq.ubc.ca/the-nude-mouse-a-science-creative-quarterly-pin-up-no-1-3/) - - FROM THE ARCHIVE - (CLICK HERE FOR PIN-UP POSTER - pdf file ~250k) -- We suggest photocopying at 129% - LTR to 11x17 -- Earlier this week, we had the chance to sit down with a member of a growing army of naked bubble mice. In thousands of biology labs around the globe, these - [OPEN LETTER TO THE KANSAS SCHOOL BOARD.](https://www.scq.ubc.ca/open-letter-to-the-kansas-school-board-2/) - - FROM THE ARCHIVE - I am writing you with much concern after I read of your hearing to decide whether the alternative theory of Intelligent Design to be taught along with the theory of Evolution. I think we can all agree that it is important for students to hear multiple viewpoints so they can - [SELECTED EXAMPLES OF WHAT YOU WILL LEARN AT THE BLACK HOLE HUMOR WORKSHOP](https://www.scq.ubc.ca/selected-examples-of-what-you-will-learn-at-the-black-hole-humor-workshop-2/) - - FROM THE ARCHIVE - Black holes are a captivating subject for any audience. At the Advanced Physics Laboratory's Black Hole Humor Workshop, you will absorb high level content and assimilate effective strategies for incorporating black hole humor into any social or professional situation. With an effective repertoire of scintillating black hole humor, you will - [WHO IS THE GREATEST SCIENTIST OF THEM ALL?](https://www.scq.ubc.ca/who-is-the-greatest-scientist-of-them-all-2/) - - FROM THE ARCHIVE - Who is the greatest scientist of them all? With no objective way of comparing scientists from different disciplines and eras the debate has raged for time immemorial leading to more than one disagreement, most notably the 1982 Falkland Islands war which began when Margaret Thatcher refused to even consider General - [HIERARCHY OF NEEDS FOR PARENTS](https://www.scq.ubc.ca/hierarchy-of-needs-for-parents-2/) - - FROM THE ARCHIVE - (In 1943 Abraham Maslow gave us his psychological theory of the Hierarchy of Needs. His theory, simply stated, posits that humans inherently seek higher and higher levels of needs, starting with the basic physiological and ending with self-actualization. One needs to meet each "lower" need in order to seek the - [AN ANTHROPOLOGICAL ANALYSIS CIRCA 3005](https://www.scq.ubc.ca/an-anthropological-analysis-circa-3005-2/) - - FROM THE ARCHIVE - In reviewing the University's ancient imagery archives, I was astounded and pleased to discover an interesting, albeit short, fragment of 20th-century photomechanical film. Apparently produced at some time in the late 1900's, it depicts a brief but fascinating moment in the lives of three young humans of the time. The - [TWO GUYS WITH CREATIVE FACIAL HAIR DISCUSS THE MERITS OF THE FEDERAL GOVERNMENT'S INVOLVEMENT IN THE TERRI SCHIAVO CASE](https://www.scq.ubc.ca/two-guys-with-creative-facial-hair-discuss-the-merits-of-the-federal-governments-involvement-in-the-terri-schiavo-case-2/) - - FROM THE ARCHIVE - Hey, bro. Hey. What's up? Not much. You? Not much. Just had a burrito. Cool. Yeah. ... ... Was it good? Was what good? The burrito. Oh, right. Yeah, it was. Cool. Yep. ... ... What kind burrito was it? Veggie. Cool. Yeah, it was a pretty cool burrito, bro. - [HISTORY'S GREATEST MINDS TACKLE SCIENCE'S GREATEST UNSOLVED MYSTERIES](https://www.scq.ubc.ca/historys-greatest-minds-tackle-sciences-greatest-unsolved-mysteries-2/) - - FROM THE ARCHIVE - Dark Matter En route to Daphne’s uncle’s seaside cabin, Scooby Doo and the rest of the Mystery Inc. gang are waylaid at an abandoned amusement park - which, according to the kindly local innkeeper, is haunted by matter that cannot be detected from the light which it emits. So mysterious - [AFRICAN LION FAMILY OBJECTS TO THEIR PORTRAYAL IN RECENT DISCOVERY CHANNEL DOCUMENTARY](https://www.scq.ubc.ca/african-lion-family-objects-to-their-portrayal-in-recent-discovery-channel-documentary-3/) - - FROM THE ARCHIVE - Papa Lion (Carl) First off, that tree we were lying around in the shade by, that wasn’t even our tree. The producers literally brought in that tree and told us it was going to be our new tree. They said our tree—the tree we’ve lay under for years—“didn’t have a - [DRUGS ARE THE ANSWER](https://www.scq.ubc.ca/drugs-are-the-answer-2/) - - FROM THE ARCHIVE - Okay. Experiments are failing. Confidence is disappearing. Each dark day feels a little more desperate than the last. I am in dire need of course correction and I’ve stumbled onto an absolutely foolproof solution that will undoubtedly have me rocking the bench again very, very soon. Drugs. That’s right. Drugs - [MY MASSIVE ROBOTIC NASA ARM](https://www.scq.ubc.ca/my-massive-robotic-nasa-arm-3/) - - FROM THE ARCHIVE - 1 Went to the mall today. Bought some boxer briefs and an Icee. Stopped into the arcade and lost to some punk kid at Street Fighter II. It's hard for me to push the buttons at the right time. Shuttle Remote Manipulator Prostheses (SRMP) destroyed Street Fighter machine. 2 Saw - [HOT SCIENCE-Y GUY OF THE MONTH - JAMES DYSON](https://www.scq.ubc.ca/hot-science-y-guy-of-the-month-james-dyson-2/) - - FROM THE ARCHIVE - Presenting: A week of Hot Science-y Guys This month's Hot Science-y Guy really sucks. Okay, James Dyson doesn't suck, but his inventions sure as heck do. Just ask my friend, Bob, who recently purchased the Dyson Animal Model No. I-Don't-Know−Exactly-but-It's-a-Lovely-Shade-of-Purple. Oooh... a purple vacuum... And boy-oh-boy! I sure would like - [HOT SCIENCE-Y GUY OF THE MONTH - NUVIA CRISOL GUERRA](https://www.scq.ubc.ca/hot-science-y-guy-of-the-month-nuvia-crisol-guerra-2/) - - FROM THE ARCHIVE - Presenting: A week of Hot Science-y Guys Something a little different this time, people. This month’s Hot Science-y Guy of the Month isn’t a guy (as if you need me to tell you that). But she is hot (like en fuego-y and muy caliente hot). And she’s very science-y. So - [HOT SCIENCE-Y GUY OF THE MONTH - JAY INGRAM](https://www.scq.ubc.ca/hot-science-y-guy-of-the-month-jay-ingram-2/) - - FROM THE ARCHIVE - Presenting: A week of Hot Science-y Guys Check this out! Canada’s own Jay Ingram’s got the posing-with-the-hand-thing going on! Now, it’s not so rakish a pose as naughty Nikola Tesla (see last Hot Science-y Guy installment), but it’s there, oh yes! So, you know what that means? Jay Ingram is - [HOT SCIENCE-Y GUY OF THE MONTH – NIKOLA TESLA](https://www.scq.ubc.ca/hot-science-y-guy-of-the-month-–-nikola-tesla-2/) - - FROM THE ARCHIVE - Presenting: A week of Hot Science-y Guys His eponymous coils aren’t the only thing that created a buzz and a sizzle! So he’s been dead since 1943. Minor detail. Nikola Tesla was one helluva hot ticket in his time and no doubt he was well aware of it, too. No - [HOT SCIENCE-Y GUY OF THE MONTH - KAYSAR RIDHA](https://www.scq.ubc.ca/hot-science-y-guy-of-the-month-kaysar-ridha-2/) - - FROM THE ARCHIVE - Presenting: A week of Hot Science-y Guys Aw heck, it’s nearly Labour Day, so let’s just call this lovely man the Hot Science-y Guy of the Summer and be done with it. Now I doubt if he’s going to include that on his updated résumé, but one thing I am - [5 HOT SCIENCE-Y GUYS](https://www.scq.ubc.ca/5-hot-science-y-guys-2/) - - FROM THE ARCHIVE - Presenting: A week of Hot Science-y Guys 1. Sir Martin Rees I don’t know if this guy’s straight or gay, and I don’t care. He’s got a certain polished appeal going on, and he’s the freaking Astronomer Royal for crying out loud. What does that mean, you ask? How does - [PHOTOSYNTHESIS - PART I: THE LIGHT REACTION (AS TOLD BY GRANNY)](https://www.scq.ubc.ca/photosynthesis-part-i-the-light-reaction-as-told-by-granny-2/) - - FROM THE ARCHIVE - -- Watch/Download the movie (~75Mb mpeg file) -- Description: A short 7 minute claymation film starring a rather busty, arguably homely (even for plasticine) woman with a shrill british accent, who takes the time to detail the biochemistry behind the light reaction of photosynthesis. - [MY LLAMA COULD BEAT UP YOUR LLAMA](https://www.scq.ubc.ca/my-llama-could-beat-up-your-llama-3/) - - FROM THE ARCHIVE - Inspired by: Cavalcanti, S.M.C. and Knowlton F.F., 1998. Evaluation of physical and behavioral traits of llamas associated with aggressiveness toward sheep-threatening canids. Applied Animal Behaviour Science, 61(2): 143-158 Franklin, W.L. and Powell, K., 1993. Guard llamas. Iowa State University—University Extension Publication, Ames, IA, 12 pp. Markham, D., 1990. Llamas Are - [A MISPLACED CHAPTER FROM THE BOOK OF GENESIS](https://www.scq.ubc.ca/a-misplaced-chapter-from-the-book-of-genesis-3/) - - FROM THE ARCHIVE - And lo, it came to be that God was sitting around in his Lazy-God recliner one quiet millennium, and He sayeth unto His Godlike self: "God is bored and needs some entertainment." And lo, God created the Earth and all it's inhabitants without getting up from the Lazy-God chair, even - [WHEN CELEBRITIES, WHO HAVE BEEN CLONED IN THE MOVIES, GET TOGETHER FOR A COFFEE](https://www.scq.ubc.ca/when-celebrities-who-have-been-cloned-in-the-movies-get-together-for-a-coffee-2/) - - FROM THE ARCHIVE - SETTING: A Starbucks in L.A. - three celebrities are sitting at a table with their coffees and sharing a newspaper, a fourth is walking towards the table with his coffee. FADE IN MICHAEL KEATON (Approaching the table) Man, I really need this now. (Sits down, whilst the others nod or - [THE SECRETS OF PARENTING THAT NO ONE WILL TELL YOU](https://www.scq.ubc.ca/the-secrets-of-parenting-that-no-one-will-tell-you-2/) - - FROM THE ARCHIVE - Parenting can be very difficult. And when you become a new parent, people will give you hundreds and hundreds of books about how to be a good parent. But what they don't tell you is that there are secrets to parenting that you will not find in any book, even - [THE THAMNOPHOBIA CRISIS](https://www.scq.ubc.ca/the-thamnophobia-crisis-2/) - - FROM THE ARCHIVE - Because the deadly scourge of thamnophobia moves slowly, many of its social, political, and economic effects have yet to be understood. The impact is hard to overstate. But we must be up to the task. The other day, I was talking to a colleague, a highly educated and intelligent person - [THE CRAIGSLIST EUTHANIST THEORY](https://www.scq.ubc.ca/the-craigslist-euthanist-theory-2/) - - FROM THE ARCHIVE - THEORY A public job listing for an animal euthanist will go over poorly. SCIENTIFIC STUDY 1:17 PM - The following is posted in the Jobs section of Craigslist: Seeking Experienced Euthanist for Animal Facility New Jersey animal science facility seeks an experienced Euthanist. You should be skilled in euthanizing not - [LIKE, "-OMIC" GOD!](https://www.scq.ubc.ca/like-omic-god-2/) - - FROM THE ARCHIVE - Let us marvel at the proliferation of the term “ome”. First off – let’s define the term “-ome”. As near as I can tell, it means “whole” or “mass”. “-ome” takes into account the totality of a thing – it defines a field. Hence the “genome” is the sum of - [THE ETHICS OF CLONING: A DEBATE BETWEEN ME AND MY TWIN BROTHER](https://www.scq.ubc.ca/the-ethics-of-cloning-a-debate-between-me-and-my-twin-brother-2/) - - FROM THE ARCHIVE - Participants Me: Against Cloning My Younger Twin Brother: For Cloning The Moderator Introduction MODERATOR: Tonight’s debate is on a topic meriting serious discussion: the ethics of cloning. Our participants are two outspoken proponents of opposing positions. Because it is a question for all of society, we have decided to include - [PHYSICS ENVY AMONG BIOLOGISTS: FACT OR FICTION?](https://www.scq.ubc.ca/physics-envy-among-biologists-fact-or-fiction-2/) - - FROM THE ARCHIVE - Physicists often state their belief that all biologists would rather be physicists, but became biologists only because they were not very good at math. As evidence for this, they point to such findings as the fact that the vast majority of published studies in virology, cell biology, endocrinology, and even - [A MANIFESTO](https://www.scq.ubc.ca/a-manifesto-2/) - - FROM THE ARCHIVE - I am going to take Science to the people. I will start small with curbside lectures on botany and bus-based displays of electromagnetism, before moving indoors to synthesize acetaminophen in a local Starbucks - perhaps lead a roundtable discussion on nanotechnology in a booth at the back of T.G.I Fridays. - [AM I EVERYWHERE?](https://www.scq.ubc.ca/am-i-everywhere-2/) - - FROM THE ARCHIVE - Last year, I had a decidedly Jungian experience, which is odd for me as a rational scientific sort. This synchronicity event happened at a local bookstore where I was searching for an issue of a Canadian magazine called Maisonneuve, a publication nice enough to print an essay of mine. As - [A CHEMIST RESPONDS TO "A SCIENTIFIC EXPERIMENT."](https://www.scq.ubc.ca/a-chemist-responds-to-a-scientific-experiment-2/) - - FROM THE ARCHIVE - (A review and/or rebuttal to “A Scientific Experiment” by Jaime J. Weinman) Well, it's a good thing that science experiments on webpages aren't subject to the traditional anonymous peer review process. It they were, Jaime would probably get a reply something like this: "Dear Mr. Weinman, "We regret that we - [A SCIENTIFIC EXPERIMENT](https://www.scq.ubc.ca/836/) - - FROM THE ARCHIVE - Some other people were talking about the silliest things they'd ever done. Their examples beat my own, but then, they'd done more things than I had, silly or no. The one really silly thing I'd done that they hadn't was -- and I swear this is true -- I once - [THINGS TO CONSIDER SHOULD YOU HAPPEN UPON YOUR DOPPELGANGER ON THE STREET](https://www.scq.ubc.ca/things-to-consider-should-you-happen-upon-your-doppelganger-on-the-street-2/) - - FROM THE ARCHIVE - Do not panic. Remain calm. A level head is key in any doppelganger situation. There's no reason to assume that your doppelganger is harboring nefarious intentions without first considering all the possibilities. Is it possible that your doppelganger is simply a dead ringer? A good three out of five doppelgangers - [LIMERICKS OF EVOLUTION](https://www.scq.ubc.ca/limericks-of-evolution-2/) - - FROM THE ARCHIVE - - - - There once was a young man named Darwin Who spent five years tossed to the far wind He wrote a book for his peers After only twenty short years And now he's as pop as George Carlin. They say we all came from a monkey But I - [PARENTS AS A NARCOTIC](https://www.scq.ubc.ca/parents-as-a-narcotic-2/) - - FROM THE ARCHIVE - Last weekend, Candace, Will and I visited my mother. And, while I was there, I realized I was very tired. Granted, I had not slept well the night before, but it suddenly occurred to me that I am often tired when I visit my mother. Then, on the way home, - [JOKES WITHOUT PUNCHLINES TAKEN FROM A CELLULAR BIOLOGY LABORATORY](https://www.scq.ubc.ca/jokes-without-punchlines-taken-from-a-cellular-biology-laboratory-2/) - - FROM THE ARCHIVE - 1. A chemical microbiologist, a pathologist and a clown are flying in a small commuter plane between Kansas City and Omaha. Halfway there, the plane bursts into flames and the pilot bails out. The passengers discover there are only two parachutes. Which one dies? 2. 1,4-dihydro-2,6-dimethyl-4-(2-nitrophenyl)-3,5-pyridinedicarboxylic acid dimethyl ester walks - [WHAT'S NEW IN SCANTRON TECHNOLOGIES](https://www.scq.ubc.ca/whats-new-in-scantron-technologies-2/) - - FROM THE ARCHIVE - The Scantron 8950 (A.K.A. “Lil’ Helper”). Attention, teachers! How many times have you arrived at the scantron machine with your stack of answer sheets and realized that you forgot to fill out the answer key? And where is your pencil? Hang on, because help is on the way. The 8900 - [SHAFTED AGAIN BY NOBEL](https://www.scq.ubc.ca/shafted-again-by-nobel-2/) - - FROM THE ARCHIVE - I didn't win the Nobel Prize in Physics again this year. What's a guy got to do to win that thing? I was made to win that prize, but for like the umpteenth time in a row I've been given the shaft. Annoying! Who cares if I'm not a physixcist - [MOTHER GOOSE AND THE SCIENTIFIC PEER REVIEW PROCESS.](https://www.scq.ubc.ca/mother-goose-and-the-scientific-peer-review-process-2/) - - FROM THE ARCHIVE - Jack and Jill went up the hill. To fetch a pail of water. Jack fell down and broke his crown. And Jill came tumbling after. First of all, we are not sure there’s enough clarity in this text. Scientific literature, in particular, should leave little room for confusion. Where exactly - [TO TEACH THE CALCULUS, A PLAY](https://www.scq.ubc.ca/to-teach-the-calculus-a-play-2/) - - FROM THE ARCHIVE - The recent popularity of math and science based plays and movies, such as "Proof", "A Beautiful Mind", and "Copenhagen", has catalyzed the recovery of lost plays from famous mathematicians and scientists themselves. Below is the complete text of "To Teach the Calculus," which was recently "recovered" from the notebooks of - [RANK: ANIMAL ILLNESSES](https://www.scq.ubc.ca/rank-animal-illnesses-2/) - - FROM THE ARCHIVE - Chicken Pox This is the Frank Sinatra of animal-themed sicknesses. A timeless classic, although the younger generations might not appreciate it. I remember fondly going to a Fourth of July Parade as a child, just recovering from the pox, and my mom not letting me look around too much lest - [SUGAR AND DEMONS: A SCIENTIST'S FIELD NOTES](https://www.scq.ubc.ca/sugar-and-demons-a-scientists-field-notes-2/) - - FROM THE ARCHIVE - Day 1: While changing my thirteen month old son's diaper, he begins to spin around and around on the bed at an extremely fast pace and giggles loudly to himself, like a madman. This is not his usual behavior. I decide to investigate. Day 2: After spending all night breaking - [POLIO: A VIRUS' STRUGGLE](https://www.scq.ubc.ca/polio-a-virus-struggle-3/) - - FROM THE ARCHIVE - Download the pdf (14pages, ~2.7Mb) - [POLIO: A VIRUS' STRUGGLE](https://www.scq.ubc.ca/polio-a-virus-struggle-2/) - - FROM THE ARCHIVE - Download the pdf (14pages, ~2.7Mb) - [PHOTO OF A NICE SET OF BOOBIES WE SAW AT THE MUSEUM OF NATURAL HISTORY](https://www.scq.ubc.ca/photo-of-a-nice-set-of-boobies-we-saw-at-the-museum-of-natural-history-2/) - - FROM THE ARCHIVE - - [THE BESTEST, MOST KICK ASS, HUMAN GENOME PROJECT](https://www.scq.ubc.ca/the-bestest-most-kick-ass-human-genome-project-2/) - - FROM THE ARCHIVE - Mondo-Genetic-Services is proud to announce its latest venture, “The Bestest, Most Kick Ass, Human Genome Project.” Hot on the tails of the International Human Genome Sequencing Consortium and Celera Genomics, we present to you a novel approach in the elucidation of mankind’s blueprint of life. Rather than using the frequently - [HOW I GOT OUT OF WRITING AN ESSAY ON H.G. WELLS' THE TIME MACHINE.](https://www.scq.ubc.ca/how-i-got-out-of-writing-an-essay-on-hg-wells-the-time-machine-3/) - - FROM THE ARCHIVE - January 17, 2005 I received the syllabus for my Humanities course. A humanities course should not be required for my B.Sc. degree in Physics. To add insult to injury, we are supposed to do an analysis of Well’s The Time Machine. We are to focus on the historical context when - [HOW I GOT OUT OF WRITING AN ESSAY ON H.G. WELLS' THE TIME MACHINE.](https://www.scq.ubc.ca/how-i-got-out-of-writing-an-essay-on-hg-wells-the-time-machine-3-2/) - - FROM THE ARCHIVE - January 17, 2005 I received the syllabus for my Humanities course. A humanities course should not be required for my B.Sc. degree in Physics. To add insult to injury, we are supposed to do an analysis of Well’s The Time Machine. We are to focus on the historical context when - [HOW THE SCIENTIFIC DEVELOPMENTS ELUCIDATED IN SCIENCE MAGAZINE WILL AFFECT MY LIFE (VOLUME 2)](https://www.scq.ubc.ca/how-the-scientific-developments-elucidated-in-science-magazine-will-affect-my-life-volume-2-2/) - - FROM THE ARCHIVES - Papers Discussed: 1.Ira M. Longini Jr. et al., Containing Pandemic Influenza at the Source, Science, 2005, 309:5737, pp1083-1087. 2. Marcel Cardillo et al., Multiple Causes of High Extinction Risk in Large Mammal Species, Science, 2005, 309:5738, pp 1239-1241 3. Andreas Olsson et al., The Role of Social Groups in the - [HOW THE SCIENTIFIC DEVELOPMENTS ELUCIDATED IN SCIENCE MAGAZINE WILL AFFECT MY LIFE (VOLUME 2)](https://www.scq.ubc.ca/how-the-scientific-developments-elucidated-in-science-magazine-will-affect-my-life-volume-2-2-2/) - - FROM THE ARCHIVES - Papers Discussed: 1.Ira M. Longini Jr. et al., Containing Pandemic Influenza at the Source, Science, 2005, 309:5737, pp1083-1087. 2. Marcel Cardillo et al., Multiple Causes of High Extinction Risk in Large Mammal Species, Science, 2005, 309:5738, pp 1239-1241 3. Andreas Olsson et al., The Role of Social Groups in the - [TOPICS DISCUSSED SO FAR](https://www.scq.ubc.ca/topics-discussed-so-far/) - This is home to the list of topics dicussed when the Vancouver chapter of the Order of the Science Scouts of Exemplary Repute and Above Average Physique has been in session. Go here for the Order's homepage (and for badges). (more badges here) - - - TOPICS Whereby drinks with Jay Ingram partly entails at - [HOW THE SCIENTIFIC DEVELOPMENTS ELUCIDATED IN SCIENCE MAGAZINE WILL AFFECT MY LIFE (VOLUME 1)](https://www.scq.ubc.ca/how-the-scientific-developments-elucidated-in-science-magazine-will-affect-my-life-volume-1-2/) - - FROM THE ARCHIVES - Papers Discussed: 1. Jeffrey B. Bingenheimer, et al., Firearm Violence Exposure and Serious Violent Behavior, Science, 2005, 308:5726, pp1323-1326. 2. Paolo A. Mazzali et al., An Asymmetric Energetic Type Ic Supernova Viewed Off-Axis, and a Link to Gamma Ray Bursts, Science, 2005, 308:5726, pp 1284-1287 3. Roger Guimerà et al., - [HOW THE SCIENTIFIC DEVELOPMENTS ELUCIDATED IN SCIENCE MAGAZINE WILL AFFECT MY LIFE (VOLUME 1)](https://www.scq.ubc.ca/how-the-scientific-developments-elucidated-in-science-magazine-will-affect-my-life-volume-1-2-2/) - - FROM THE ARCHIVES - Papers Discussed: 1. Jeffrey B. Bingenheimer, et al., Firearm Violence Exposure and Serious Violent Behavior, Science, 2005, 308:5726, pp1323-1326. 2. Paolo A. Mazzali et al., An Asymmetric Energetic Type Ic Supernova Viewed Off-Axis, and a Link to Gamma Ray Bursts, Science, 2005, 308:5726, pp 1284-1287 3. Roger Guimerà et al., - [TRASH TALKIN' AT THE AQUARIUM](https://www.scq.ubc.ca/trash-talkin-at-the-aquarium-2/) - - FROM THE ARCHIVE - Wut up, tortoise? You think you're all that 'cause you can swim really well and stuff? Well, sorry to disappoint you, son, but I can swim really well, too. Sucka. I need to wear water wings, on account I'm scared of deep water, but that's still swimming. So bite me, - [BUTTERFLY](https://www.scq.ubc.ca/butterfly-2/) - - FROM THE ARCHIVE - This piece is copyrighted (2004), Chris Ware, and reprinted with permission from McSweeney's Quarterly Concern Issue 13 - [THE SOCIAL NORM OF LEAVING THE TOILET SEAT DOWN: A GAME THEORETIC ANALYSIS](https://www.scq.ubc.ca/the-social-norm-of-leaving-the-toilet-seat-down-a-game-theoretic-analysis/) - The issue of whether the toilet seat should be left up or down after use seemingly generates a lot of passion among the parties concerned, however, scientific inquiries into the matter are almost non-existent. Notable exceptions are Choi (2002) and Harter (2005). Choi (2002) argues that the rule of leaving the toilet seat down after - [THE LAST CANARY IN THE COAL MINE: SMALL, YELLOW, AND OMINOUSLY SILENT](https://www.scq.ubc.ca/the-last-canary-in-the-coal-mine-small-yellow-and-ominously-silent/) - Over the past fifty years, anomalies have occurred within Earth’s atmosphere, hydrosphere, and biosphere. Some of these have caught the attention of scientists and environmentalists only, while others have produced media frenzies. Rachel Carson’s Silent Spring identified the risks of bioaccumulation to egg-laying animals, especially raptors (1962); habitat destruction led to the near extinction of - [DR SCIENCE AND ME](https://www.scq.ubc.ca/dr-science-and-me/) - As a real scientist, I have hated the "Ask Dr. Science" humorous newspaper column ever since I was a small child. I mean, this man, this "Dr. Science," who writes the column is obviously deranged: a compulsive liar who seems to know almost nothing about science. In contrast, I was almost a child genius who - [ALL CHANGE IS NOT EVOLUTIONARY](https://www.scq.ubc.ca/all-change-is-not-evolutionary/) - What is evolution? Who was Darwin? What do the words Darwinism, natural selection, or survival of the fittest really mean? These words and phrases have been bandied around over the past century, used interchangeably, frequently in the news, and known very much as players of one of the most controversial topics in our society today. - [METRICS: THE CELCIUS](https://www.scq.ubc.ca/metrics-the-celcius/) - Metric: Celsius Measures: Primarily the vibrational and rotational kinetic energy of atoms (you know, hotness). Range: -273.15oC. This is known as absolute zero, a temperature at which nothing could be colder. Some Irishman named Kelvin came up with a scale that started 0 from this value, but basically had the same increments as the Celsius - [JOURNAL CLUB FIND: HOW TO BE A BORING WRITER - THE STUDY.](https://www.scq.ubc.ca/journal-club-find-how-to-be-a-boring-writer-the-study/) - Fig. 1. ‘‘Congratulations, you are now capable of writing technical, impersonal and boring papers like myself and the other gentlemen - Drawing by Sverre Stein Nielsen. REFERENCE: How to write consistently boring scientific literature (page 1 pdf). (2007) Oikos 116: 723 - 727. ABSTRACT: Although scientists typically insist that their research is very exciting and - [THE PURSUIT OF HAPPINESS (A.K.A. IT APPEARS THAT THE WRITER WROTE ABOUT BANANAS AFTER EATING A FEW TOO MANY)](https://www.scq.ubc.ca/the-pursuit-of-happiness-aka-it-appears-that-the-writer-wrote-about-bananas-after-eating-a-few-too-many/) - Both scientific research and personal experiences are proving, without a doubt, that there is a connection between what we eat and how we think and act - hence the saying “you are what you eat”. This happy-food-to-happy-mood relationship is bridged by “happy” neurotransmitters in our bodies. Just think of “happy” neurotransmitters as the money-orders from - [THE MURPHY'S LAW EQUATION](https://www.scq.ubc.ca/the-murphys-law-equation/) - There are many laws in the physical sciences, most of which have mathematical equations that govern them. Widely know laws such as the laws of electricity and magnetism, have Maxwell’s equations. Fluid-flow is governed by the Navier-Stokes equations, and of course everyone is familiar with Einstein’s energy to mass relation, E=mc2. Why then does an - [OBESITY AND DIABETES: A CANADIAN EPIDEMIC](https://www.scq.ubc.ca/obesity-and-diabetes-a-canadian-epidemic/) - Kahnawake is a Mohawk community of 7000 people, located 12 miles north of Montreal, Quebec, on the bank of the St. Lawrence River. Originally settled in 1680, the community traditionally relied on fishing and hunting for food, as well as gathering corn, beans and squash from the area. However, despite the healthy meat and vegetable - [pH - A SCIENCE CREATIVE QUARTERLY PIN UP (NO. 2)](https://www.scq.ubc.ca/ph-a-science-creative-quarterly-pin-up-no-2/) - (CLICK HERE FOR PIN-UP POSTER - pdf file ~140k) – We suggest photocopying at 129% - LTR to 11×17 – Metric: pH Range: 0-14 (no units) Measures: Degree of acidity or alkalinity. It is a logarithmic scale expressing the concentration of Hydrogen ions in solution. pH = -log10 [H+] A solution is “acidic” if pH - [SCRUBBED (WHITE COAT, STILL WRONG TIME)](https://www.scq.ubc.ca/white-coat-wrong-time-again/) - Read the first installment here Today, I encountered a surgeon at Starbucks. His scrubs and lab coat weren’t surprising and neither was his flashy that’s-right-I’m-a-funky-surgeon bandana. In this neighbourhood (I work and live by Vancouver General Hospital), I guess we all become somewhat inured to this practice. What did make this particular instance surprising was - [A CONVERSATION WITH YOUR HEART: CARDIAC BIOMARKERS - INSIGHT INTO THE PAST, PRESENT, AND FUTURE.](https://www.scq.ubc.ca/a-conversation-with-your-heart-cardiac-biomarkers-insight-into-the-past-present-and-future/) - Dr. McCondo: “So, how are you feeling today? You told the nurse you were feeling a little sick?” Mr. Heart: “Not well, and I think I might be coming down with something serious…” Dr. McCondo: “Alright, let’s take a look.” Mr. Heart: “Okay…hey do you think it’s going to be something serious? Do you think - [THE LONELY STRUGGLE OF THE POLITICIZED ARTEMIA SALINA*](https://www.scq.ubc.ca/the-lonely-struggle-of-the-politicized-artemia-salina/) - This pool, this salty shrine, This place from whence all good things come -- This is my home. Like all of you, I bask and breed And swim from day to day; I juggle eggs and food, Absorb the sunlight when I can, And rarely take the time to think and brood Upon that larger - [ANNOUNCING: SCIENCE SCOUTS NOW ON FACEBOOK](https://www.scq.ubc.ca/announcing-science-scouts-now-on-facebook/) - science scouts home | facebook group We are delighted at the awesome response for the Science Scouts (many thanks to BoingBoing in particular), and are truly inspired by the many who view scientific literacy and badges with such passion. In order to best manage the many individuals who would like to keep up with the - [A BEHIND THE SCENES SITE OVERHAUL AND AN INVITATION TO JUST PAUSE FOR A MOMENT AND THINK.](https://www.scq.ubc.ca/behind-the-scenes-site-overhaul-and-an-invitation-to-just-pause-for-a-moment-and-think/) - Apologies if the Science Creative Quarterly site misbehaves today. We're incorporating fancy and not-so-fancy upgrades - primarily to protect things like the truth and to introduce neat little sphere widgets. Since there is nothing new today, per se, we invite you to stop whatever it is you're doing, look outside (or better yet, go outside) - [BLOBAL WARMING](https://www.scq.ubc.ca/blobal-warming/) - The latest scientific reports on climate change trot out all the familiar devastating consequences of global warming: Melting ice caps, rising sea levels, shifting weather patterns, super-hurricanes, species extinctions, droughts, drowning polar bears. Now I'm going to tell you something really scary--the single most terrifying threat that global warming poses to mankind, and one you've - [SCIENCE, RELIGION, AND THE CREATION OF LIFE ON EARTH](https://www.scq.ubc.ca/science-religion-and-the-creation-of-life-on-earth/) - Introduction I have found that one of the difficulties in discussing religion is often a matter of semantics. Consequently, I would like to begin by providing the context for the following discussion. I am a Christian; and while I have made active efforts in understanding other faiths, I am not knowledgeable enough to give an - [THE 2007 SCIENCE SPRING SHOWDOWN - GAME ON!](https://www.scq.ubc.ca/the-2007-science-spring-showdown-game-on/) - (Originally presented here) (Download Bracket) PDF | JPG (Follow all games here) BEN: Welcome, Ladies and Gentleman to the 2007 SCIENCE SPRING SHOWDOWN - the thinking person's ccomplement to the NCAA tournament! Sponsored by the fine folks at ScienceBlogs Basic Concepts. That's right people, it's the dance, and we're here at the World's Fair bringing - [TEN BASIC HEURISTIC PRINCIPLES FOR ACADEMIC TEXT CRAFTING OR HOW TO PUBLISH A PAPER IN A PEER-REVIEWED JOURNAL](https://www.scq.ubc.ca/ten-basic-heuristic-principles-for-academic-text-crafting-or-how-to-publish-a-paper-in-a-peer-reviewed-journal/) - You don't need to be a scientist, you don't even need to have a college education. Anyone can do it. Just follow these 10 simple rules: 1) Select the Social Sciences discipline of your choice: History, Anthropology, or Linguistics, whatever makes you tick. 2) Make up an outrageous hypothesis. Whatever crosses your mind - no - [THE ELDERSBY MODEL: A SUCCESSFUL GRAND UNIFICATION THEORY](https://www.scq.ubc.ca/the-eldersby-model-a-successful-grand-unification-theory/) - Last last Tuesday, a successful Grand Unification Theory (GUT) was accidentally found by a Mrs Eldersby of 29 Pennyfarthing Lane, London. Despite her having no formal training in any science discipline, and the fact that the solution was arrived upon by a series of highly unscientific events, the Eldersby Model - as it is being - [ACADEMIA-INDUSTRY - ALLIANCE AT WHAT COST?](https://www.scq.ubc.ca/academia-industry-alliance-at-what-cost/) - Academia -Industry relationship The Academia-industry collaborations involve transforming an intelligent laboratory research into an industrial application of that knowledge, to provide goods and services for the society. The Bayh-Dole Act, enacted in 1980, details the rules and regulations for collaborations between private industry and research institutions, such as universities and since then, financial relationships between - [TEXTBOOK MANUFACTURERS CHANGE FUNDAMENTAL LAWS OF NATURE](https://www.scq.ubc.ca/textbook-manufacturers-change-fundamental-laws-of-nature/) - A new edition of the laws of physics was released yesterday evening, with sweeping consequences for people everywhere. Anxiety was widespread on campuses around the world as the new laws took effect. Students awoke this morning to a number of inexplicable changes, such as a gravitational constant that had more than doubled, and water that - [ANALYSES OF THE SIX DEGREES OF SEPARATION OF BACONS OTHER THAN KEVIN BACON](https://www.scq.ubc.ca/analyses-of-the-six-degrees-of-separation-of-bacons-other-than-kevin-bacon/) - Sir Francis Bacon, British philosopher, essayist, and scientific revolution advocate (1561 - 1626): Quite a few of them are dead. B.L.T., sandwich: A lot depends on whether the lettuce and tomato count as one degree. Bacon County, Georgia: Geographically speaking, could get you as far as Florida or South Carolina Canadian Bacon, meat cut: Network - [GENITAL WARTS - DEATH THROUGH IMMORTALITY, IMMORTALITY THROUGH DEATH](https://www.scq.ubc.ca/genital-warts-death-through-immortality-immortality-through-death/) - Genus Papillomaviridae Species Human Papillomavirus Spurting viruses from your crotch I’ll start by saying warts irk me out. Perhaps not as much as jellyfish, but they’re up there. It really sucked researching and looking up pictures for this topic; I hope you all appreciate it. In fact, appreciate it even more that I didn’t include - [DIGGING IN THE DIRT: IS THE STUDY OF THE RHIZOSPHERE RIPE FOR A SYSTEMS BIOLOGY APPROACH?](https://www.scq.ubc.ca/digging-in-the-dirt-is-the-study-of-the-rhizosphere-ripe-for-a-systems-biology-approach/) - Rhizosphere study systems biology an auspicious approach Introduction: the rhizosphere and systems biology. Both complex: maybe perfect for each other? The rhizosphere is complex. Really, really, ridiculously complex. Dauntingly complex even. Quantitatively now, soil has over 10000 distinct microbes in a single gram [7]. The term rhizosphere was coined to describe, literally, the sphere of - [THE ANTI-VACCINE DISEASE: RANT OR REASON?](https://www.scq.ubc.ca/the-anti-vaccine-disease-rant-or-reason/) - In a recent bacterial pathogenesis lecture, my class was shown a short video on whooping cough, a sometimes-fatal childhood disease caused by the bacteria Bordetella pertussis. Children no older than 2 years old were unable to breathe, taking desperate breaths in between painful coughing fits, mucus covering their faces. We had been studying the creation - [THE SHAKING PALSY: A REVIEW OF PARKINSON'S DISEASE](https://www.scq.ubc.ca/the-shaking-palsy-a-review-of-parkinsons-disease/) - A brief history What do Muhammad Ali, Michael J. Fox, Pierre Trudeau and Mao Tse Tung all have in common? They are, or have been, public faces of a debilitating disorder known as Parkinson’s disease (or “PD”). PD affects millions of people worldwide and is present in about 1% of the total global population, with - [SEX AND SMARTS: UNDER-REPRESENTATION OF WOMEN AMONG SCIENCE AND ENGINEERING FACULTY](https://www.scq.ubc.ca/sex-and-smarts-under-representation-of-women-among-science-and-engineering-faculty/) - I am in the process of becoming a scientist. A female scientist. I didn’t think that my gender was relevant to my career aspirations. I have plenty of female company (and competition) as an undergraduate science student at UBC. The ratio of women to men in my classes must be close enough to 50/50 that - [THE PERCEPTION OF SCIENTISTS](https://www.scq.ubc.ca/the-perception-of-scientists/) - Scientists have an image problem. Just ask any fifth-grader. Chances are, they’ll probably tell you that a scientist is Caucasian, male, can be found wearing a lab coat, and leads a lonely laboratory existence [1]. Perhaps he has eccentric character traits or odd-looking hair [2]. That’s some fairly discouraging news, but hey, what do kids - [EBPR METAGENOMICS: THE SOLUTION TO POLLUTION IS BIOTECHNOLOGICAL REVOLUTION](https://www.scq.ubc.ca/ebpr-metagenomics-the-solution-to-pollution-is-biotechnological-revolution/) - The SCQ is happy to partake in the Week of Science initiative, and will have only textbook pieces for this particular week. If you need a breather, please take a moment to peruse our humour section. That should work nicely - - - Brief With the recent application of metagenomic techniques to wastewater treatment, the - [THE THRILL OF THE RIDE: A BRIEF OVERVIEW OF THE HISTORY AND SCIENCE OF ROLLER COASTERS](https://www.scq.ubc.ca/the-thrill-of-the-ride-a-brief-overview-of-the-history-and-science-of-roller-coasters/) - The SCQ is happy to partake in the Week of Science initiative, and will have only textbook pieces for this particular week. If you need a breather, please take a moment to peruse our humour section. That should work nicely - - - “Considering how dangerous everything is, nothing is really very frightening.” ~Gertrude Stein - [WHY IS THE MORNING AFTER PILL CALLED THE MORNING AFTER PILL?](https://www.scq.ubc.ca/why-is-the-morning-after-pill-called-the-morning-after-pill/) - The SCQ is happy to partake in the Week of Science initiative, and will have only textbook pieces for this particular week. If you need a breather, please take a moment to peruse our humour section. That should work nicely - - - DISCLAIMER: This article is intended to help readers understand the role of - [AGRICULTURAL REVOLUTION](https://www.scq.ubc.ca/agricultural-revolution/) - The SCQ is happy to partake in the Week of Science initiative, and will have only textbook pieces for this particular week. If you need a breather, please take a moment to peruse our humour section. That should work nicely - - - The environment is a hot topic these days, with most people being - [COMPARISONS OF THEORIES ON THE ORIGIN OF LANGUAGE: LANGUAGE ON THE BRAIN](https://www.scq.ubc.ca/comparisons-of-theories-on-the-origin-of-language-language-on-the-brain/) - Dedicated to the memory of John-Christian Solomon. “Darmok and Jalad at Tanagra. Sokath, his eyes uncovered!” Apart from linguistic historians, researchers from other fields are also hungry for revelations; Artificial Intelligence researchers are eager to see how to apply it in cases of complex dynamical systems and in imbuing artifacts with the capacity to learn - [DENATURING GRADIENT GEL ELECTROPHORESIS (DGGE): AN OVERVIEW](https://www.scq.ubc.ca/denaturing-gradient-gel-electrophoresis-dgge-an-overview/) - Imagine a scenario, where you have a patient with a life-threatening infection. Such a patient might require prompt antimicrobial therapy. However, in clinical microbiology, there is this constant race against the clock in identifying these disease-causing organisms so that an effective treatment can be provided. In fact, often, it is only after the death of - [TRANSFUSION MEDICINE: THE BASIS AND THE FUTURE](https://www.scq.ubc.ca/transfusion-medicine-the-basis-and-the-future/) - “Blood, it’s in you to give”. So proclaims in a recruitment campaign by the Canadian Blood Services, hoping to encourage more Canadians to donate [1]. Undoubtedly, blood plays an eminent role in the normal function of all systems in the body. And in modern medicine, blood is used as a therapeutic modality in procedures such - [ON WHOSE SHOULDERS WE STAND: REFLECTIONS ON A HISTORICAL DEBATE CONCERNING SCIENTIFIC ETHICS](https://www.scq.ubc.ca/on-whose-shoulders-we-stand-reflections-on-a-historical-debate-concerning-scientific-ethics/) - Plagiarize Let no one else's work evade your eyes Remember why the good Lord made your eyes So don't shade your eyes But plagiarize, plagiarize, plagiarize Only be sure always to call it please "research" (Tom Lehrer) - - - In his song, “Lobachevky”, American songwriter, mathematician, and satirist Tom Lehrer claims that the secret - [OUR SWEET ENDING: HEALTH CONSEQUENCES WITH HIGH FRUCTOSE CORN SYRUP CONSUMPTION](https://www.scq.ubc.ca/our-sweet-ending-health-consequences-with-high-fructose-corn-syrup-consumption/) - Obesity in our world The prevalence of obesity has increased in epidemic proportions in the last 30 years (1). The World Heath Organization estimates that there are at least 1.6 billion overweight adults globally, of which 400 million are obese (2). An overweight adult is roughly defined as one who exceeds the maximum desired weight - [COMFORT FOOD AND YOU](https://www.scq.ubc.ca/comfort-food-and-you/) - “Home sweet home,” you say to yourself as you step into your apartment. You are pretty soaked from the walk home in the rain. Who knew it was going to be sunny in the morning, suddenly snowing at noon, and raining by the afternoon? “Damn Raincouver,” you mumble, as you take off your shoes and - [SYSTEMS BIOLOGY: A SYSTEMS APPROACH TO UNDERSTANDING THE COMPLEXITY OF BIOLOGY](https://www.scq.ubc.ca/systems-biology-a-systems-approach-to-understanding-the-complexity-of-biology/) - The Scientists base their research on a principle hypothesis that complex systems can be understood by seeking out its most fundamental constituents. In other words, the complex problems are resolved by dividing them into smaller, simpler and more tractable units. Hence, physicists search for the basic particles and forces; chemists seek to understand chemical bonds; - [MSG: MORE THAN MEETS THE TONGUE](https://www.scq.ubc.ca/msg-more-than-meets-the-tongue/) - Most of our lives are spent obtaining food, preparing food, cooking food, and taking the time to savor food. Food is colourful, flavorful and simply delightful. The only drawback is wondering what our next meal is going to be. A simple solution for most working class people in the world: eating out. With such an - [TRANS FAT BEGONE!](https://www.scq.ubc.ca/trans-fat-begone/) - Perceptions of the health effects of trans fatty acids (TFA), particularly in the form of margarine, have undergone several changes during the past 10 years. What was once heralded as the healthy alternative to butter now assumes the role of coconspirator. In the 1990s, there was public health concern about epidemiological studies suggesting that high - [THE WHOLE BRAIN SCIENTIST](https://www.scq.ubc.ca/the-whole-brain-scientist/) - In today’s experiment, we are going to isolate chemical A, purify chemical B, quantify chemical C, and characterize chemical D. Then we will somehow combine A, B, C, and D in a Dr. Frankensteinesque attempt to synthesize chemical E. Chemicals A, B, C, and D are probably interchangeable, and there is no particular sequence in - [WOMEN IN MEDICAL PHYSICS](https://www.scq.ubc.ca/women-in-medical-physics/) - Traditionally, physics has been a male-dominated occupation. However, throughout history there have been exceptional women who have risen above society’s restrictions and contributed greatly to the advancement of physics. Women have played an important role in the creation, advancement and application of medical physics. As a frontier science, medical physics is less likely to be - [GOING BEYOND THE CURE: ON CONFRONTING THE FUTURE OF GENE THERAPY](https://www.scq.ubc.ca/going-beyond-the-cure-on-confronting-the-future-of-gene-therapy/) - The potential use of genetic engineering, the alteration of the genetic material (i.e. DNA) in living organisms, for therapeutic purposes, or “gene therapy”, holds the promise of curing many diseases. The potential use of gene therapy as a preventative treatment for genetic diseases, however, has been controversial, primarily because such preventative measures may involve manipulating - [DEATH FROM ABOVE: THE TORINO SCALE AND YOU](https://www.scq.ubc.ca/death-from-above-the-torino-scale-and-you/) - (Congratulations are in order for Mike, our winner of the science humour writing plus caption contest!) Are you doomed? There's only one way to find out, and that's to consult a colour-coded chart. Take, for example, the Torino Scale, which astronomers use to express the likelihood of an asteroid hitting the Earth. Asteroid impacts are - [BE VERY AFRAID](https://www.scq.ubc.ca/be-very-afraid-2/) - Since it was very much inspired by Mr. Vonnegut, we'd like to (again) present this piece to you. He will be missed. The SCQ would also like to ask, "what are you afraid of?" Comments can be left here. - - - A few months before he died, a Nobel Prize winner wandered into my - [THERE'S A WOLVERINE IN MY SCIENCE](https://www.scq.ubc.ca/theres-a-wolverine-in-my-science/) - Science has brought us to where we are now: Here. It's fairly nice here; the air smells vaguely of jasmine, the curtains are delightful - yellow was a good choice - and our lives aren't nearly as nasty, brutish and short as they once were. That tomato with the face is menacing and it seems - [IN THE DOG HOUSE](https://www.scq.ubc.ca/in-the-dog-house/) - My Very Excellent Mother used to be the soul of generosity, and her beneficence a universally-acknowledged truth. Around the world, students rejoiced when they recalled that she Just Sent Us Nine Pizzas. But as time passes, so it seems, the universe contracts; mom's liberality is capped and scientists decree that students will make do with - [ALZHEIMER'S DISEASE: SORTING THROUGH TANGLES AND CLEARING UP THE PLAQUE...](https://www.scq.ubc.ca/alzheimers-disease-sorting-through-tangles-and-clearing-up-the-plaque/) - In 1907, Dr. Alois Alzheimer published the first case study on a patient with what is now known as Alzheimer’s disease. Shakespeare almost beat him to it in the “All the World’s a Stage…” monologue from As You Like It, describing the last “scene” of a 7 part life ending in “second childishness and mere - [THE BIG ONE: UNDERSTANDING WHY THE BIG EARTHQUAKE IS PREDICTED FOR VANCOUVER](https://www.scq.ubc.ca/the-big-one-understanding-why-the-big-earthquake-is-predicted-for-vancouver/) - This morning, the front page of the national newspaper reads “BC put on alert for huge quake.” Yet again. So do I hop on a plane to Calgary or continue obliviously sipping my coffee? The reality of an eventual massive earthquake on the British Columbian coast is a given. As my mom, discontent with raging - [THE BOOK OF THWILE: A CHILDREN'S BOOK](https://www.scq.ubc.ca/the-book-of-thwile-a-childrens-book/) - "Praying to those deities in the sky, Can never account for the chickens that die "Stuffed in small cages with no room to run They squeeze out your breakfast and croak when they're done! "all day you recline on this mattress of fluff, When you barely acknowledge what gives you this stuff... DOWNLOAD THE BOOK - [IPCC FAQ PART DEUX (BURCH MIX): OR HOW TO CAPTURE THE CLIMATE CRAZE.](https://www.scq.ubc.ca/ipcc-faq-part-deux-burch-mix-or-how-to-capture-the-climate-craze/) - (Click here for the IPCC FAQ Part I) Even those living under the oft-referenced proverbial rock would find it difficult these days to avoid the tempest of public opinion, news media attention, and political rhetoric swirling around the climate change issue. On the heels of Al Gore’s turn as an Oscar winner, and the vast - [DAY 87](https://www.scq.ubc.ca/day-87/) - Jared and the dog stared each other down. Between them, the glass door was smeared with paw prints. Jared held his surgical mask in his hand. The dog couldn’t hear him over the howling and barking from back inside the building. Go away, mouthed Jared at the dog. The dog barked at him. No, mouthed - [PRODUCT MANUAL OF THE FUTURE: THE DEATH RAY](https://www.scq.ubc.ca/product-manual-of-the-future-the-death-ray/) - Congratulations on your purchase of a genuine ZapCo D-99 Death Ray. Please read these instructions thoroughly and carefully before handling, operating, or servicing your death ray. Careless or incorrect use of a death ray could result in serious injury. Message from the President Hello, fellow death ray enthusiast. You've made the right choice with the - [JOURNAL CLUB FIND: WATCHING POKEMON IS HAZARDOUS TO YOUR HEALTH](https://www.scq.ubc.ca/journal-club-find-watching-pokemon-is-hazardoud-to-your-health/) - REFERENCE: Pokemon contagion: photosensitive epilepsy or mass psychogenic illness? (2001) Southern Medical Journal 94(2):197-204. ABSTRACT: We studied a reported illness outbreak occurring on December 16, 1997, involving more than 12,000 Japanese children who had various signs and symptoms of illness after watching an episode of a popular animated cartoon, Pokemon. While photosensitive epilepsy was diagnosed - [SOYBEAN AND BALDNESS PREVENTATION: APPARENTLY, THERE IS A LINK](https://www.scq.ubc.ca/soybean-and-baldness-preventation-apparently-there-is-a-link/) - Nutritionists and vegetarians have claimed for years that soy provides a wide range of health benefits, such as lowering rates of heart attack, reducing blood cholesterol levels, relieving menopausal symptoms in postmenopausal women, and in the general enhancement of the immune system. In fact, in 1999, the Food and Drug Administration even permitted food manufacturers - [OUR HUMOUR WRITING CONTEST - ONLY THREE DAYS LEFT](https://www.scq.ubc.ca/our-humour-writing-contest-only-three-days-left/) - Basically, an almost last call for entries. And to reiterate, a humour piece is needed, plus (plus) additional captions can be supplied if you want to take a chance at modifying your score for better or for worse. Also, note that the prize rocks! (full details below) * * * PDF | JPG The Science - [A CURMUDGEONLY CLARIFICATION OF "CAVITATION" AND A CALL TO CORRECT ALL CRACKING CONTENT](https://www.scq.ubc.ca/a-curmudgeonly-clarification-of-cavitation-and-a-call-to-correct-all-cracking-content/) - Being of a curious mind, I am occasionally fascinated by simple things such as the phenomenon of cracking knuckles. In this respect, I have done some very basic research regarding this phenomenon and have been repeatedly disappointed by the explanations presented on nearly every web site I have seen that attempts to describe the process - [TUBERCULOSIS AND THE BCG VACCINE: NOT QUITE GOOD ENOUGH](https://www.scq.ubc.ca/tuberculosis-and-the-bcg-vaccine-not-quite-good-enough/) - Mycobacterium tuberculosis is one of the most virulent pathogens, infecting one third of the world’s total population (1). Tuberculosis (TB), of which M. tuberculosis is the causative agent, has become a frightening epidemic, killing almost two million people annually (1). The development of the Mycobacterium bovis bacilli Calmette-Géurin (BCG) vaccine in 1921 and its subsequent - [THE EVOLUTION OF DESIGN: ENGINEERING ENTERS THE BIOLOGICAL REVOLUTION](https://www.scq.ubc.ca/the-evolution-of-design-engineering-enters-the-biological-revolution/) - “And there are even some engineers in this [biology] class!” - a seemingly innocent remark, but one that contains sentiments often expressed in the biological realm: engineers just don’t really fit in. At first glance, nothing seems out of the ordinary with this statement - and both parties would probably agree – of course engineers - [WHEN IT'S O.K. TO ASK, "WHAT STINKS?"](https://www.scq.ubc.ca/when-its-ok-to-ask-what-stinks/) - Lab rats, let’s face it. Sometimes, some of us in science sometimes sacrifice hygiene for extra time in the lab. Got a 2-hour incubation, why not go for a jog or catch a spinning class? Have to start your 12 hour ELIZA at 4:30am to make it to your 5pm seminar, why bother showering before - [GRIMACE IS A G.M.O.](https://www.scq.ubc.ca/grimace-is-a-gmo/) - March 14, 2007, 3PM: Mildred, the maid leads me onto a sandstone patio, and I have to stop and take in the marvelous view of the San Francisco Bay. Immediately, I know that this is a place for the rich and famous, appropriate for a king or queen perhaps, and certainly fitting for a fast - [BUBBLES](https://www.scq.ubc.ca/bubbles/) - The bubbles in my bath are white; try as I might they never change despite a range of gels and goos in rainbow hues - pinks, greens and blues. The chemists say it's child's play to reproduce the scent of fruits, herbs, flowers and roots. But still the foam is monochrome. - [GLYCEROL STOCKS: THE FUTURE IS NOW](https://www.scq.ubc.ca/glycerol-stocks-the-future-is-now/) - Cryonics, the technique of freezing dead rich people and their pets, is generally disregarded as a big lame waste of money by most scientists and doctors. The goal of cryonics is to preserve all cells in the body well enough such that in the distant future, after scientists have figured out how to successfully “thaw” - [JOURNAL CLUB FIND: SORT OF PUTS THE IDEA OF 'FOOT MASSAGE' INTO A WHOLE DIFFERENT LEAGUE](https://www.scq.ubc.ca/journal-club-find-sort-of-puts-the-idea-of-foot-massage-into-a-whole-different-league/) - - - - REFERENCE: Pseudomamma on the foot: An unusual presentation of supernumerary breast tissue. (2006) Dermatology Online Journal: 12 (4): 7 ABSTRACT: A 22-year-old woman sought medical care for a lesion in the plantar region of her left foot, a well-formed nipple surrounded by areola and hair. Microscopic examination of the dermis showed hair - [THE BUDDHA IS SMILING](https://www.scq.ubc.ca/the-buddha-is-smiling/) - In the island park of Nirvana Nagar, a giant statue of the Blessed with its head in the clouds — against a golden orb, nimbused by an ethereal radiance. ‘The Buddha is Smiling’ was the codeword for the first underground nuclear tests conducted by India at the army range of Pokhran in the Thar desert. - [ARBORIS GILDIS](https://www.scq.ubc.ca/arboris-gildis/) - The Money-Tree Phenomenon Thanks to rogue geneticists, the arboris gildis tree has emerged in every continent, flying in the face of conventional wisdom, that money does not, in fact, grow on trees. The effects of arboris gildis have been catastrophic, devastating the economy, ruining the soil, and leading to an epidemic of grumbling old-timers. The - [KIDS AND COMBUSTION](https://www.scq.ubc.ca/kids-and-combustion/) - When I was in high school, I remember friends who were jealous that my parents knew math and science - since obviously that meant I could ask them for help with my homework. What my friends didn’t know was that my parents treated the most straightforward question as an invitation to a freewheeling Socratic dialogue - [HOW I GOT OUT OF WRITING AN ESSAY ON H.G. WELL'S THE TIME MACHINE.](https://www.scq.ubc.ca/how-i-got-out-of-writing-an-essay-on-hg-wells-the-time-machine-2-2/) - (Last week was reading week at UBC, but we were so freaking busy that we didn't even get a chance to rest. Therefore, this week we get to catch up on our sleep by reprinting some of our finest. Enjoy.) - FROM THE ARCHIVE - January 17, 2005 I received the syllabus for my Humanities - [AFRICAN LION FAMILY OBJECTS TO THEIR PORTRAYAL IN RECENT DISCOVERY CHANNEL DOCUMENTARY](https://www.scq.ubc.ca/african-lion-family-objects-to-their-portrayal-in-recent-discovery-channel-documentary-2/) - (Last week was reading week at UBC, but we were so freaking busy that we didn't even get a chance to rest. Therefore, this week we get to catch up on our sleep by reprinting some of our finest. Enjoy.) - FROM THE ARCHIVE - Papa Lion (Carl) First off, that tree we were lying - [MY LLAMA COULD BEAT UP YOUR LLAMA](https://www.scq.ubc.ca/my-llama-could-beat-up-your-llama-2/) - (Last week was reading week at UBC, but we were so freaking busy that we didn't even get a chance to rest. Therefore, this week we get to catch up on our sleep by reprinting some of our finest. Enjoy.) - FROM THE ARCHIVE - Inspired by: Cavalcanti, S.M.C. and Knowlton F.F., 1998. Evaluation of - [HOW I GOT OUT OF WRITING AN ESSAY ON H.G. WELL'S THE TIME MACHINE.](https://www.scq.ubc.ca/how-i-got-out-of-writing-an-essay-on-hg-wells-the-time-machine-2/) - (Last week was reading week at UBC, but we were so freaking busy that we didn't even get a chance to rest. Therefore, this week we get to catch up on our sleep by reprinting some of our finest. Enjoy.) - FROM THE ARCHIVE - January 17, 2005 I received the syllabus for my Humanities - [THE NUDE MOUSE - A SCIENCE CREATIVE QUARTERLY PIN UP (NO. 1)](https://www.scq.ubc.ca/the-nude-mouse-a-science-creative-quarterly-pin-up-no-1-2/) - (Last week was reading week at UBC, but we were so freaking busy that we didn't even get a chance to rest. Therefore, this week we get to catch up on our sleep by reprinting some of our finest. Enjoy.) - FROM THE ARCHIVE - (CLICK HERE FOR PIN-UP POSTER - pdf file ~250k) -- - [A MISPLACED CHAPTER FROM THE BOOK OF GENESIS](https://www.scq.ubc.ca/a-misplaced-chapter-from-the-book-of-genesis-2/) - (Last week was reading week at UBC, but we were so freaking busy that we didn't even get a chance to rest. Therefore, this week we get to catch up on our sleep by reprinting some of our finest. Enjoy.) - FROM THE ARCHIVE - And lo, it came to be that God was sitting - [A CHEMISTRY STUDENT'S INNER VOICE GUIDE TO ACID/BASE TITRATION](https://www.scq.ubc.ca/a-chemistry-students-inner-voice-guide-to-acidbase-titration/) - A. INTRODUCTION .: This experiment consists of two parts. The first is designed so that you may screw up and not face any further consequences. The second requires your utmost diligence, as the products from this experiment will serve as the basis of every other experiment for the rest of the semester. .: In the - [INCREASE THE N](https://www.scq.ubc.ca/increase-the-n/) - (scroll down for audio file) there's a trend but the error is big increase the N the rat's no good use the guinea pig increase the N the antibody's weak the background high increase the N my P value is bigger than pi increase the N (chorus) increase the N ramp it up i need - [RUB-A-DUB-DUB, A POLAR BEAR IN A BATH TUB](https://www.scq.ubc.ca/rub-a-dub-dub-a-polar-bear-in-a-bath-tub/) - (See here first) This is just a friendly reminder that we have a science humour writing contest going on. Go on - be funny. Do some math. Win an iPod or a whole bunch of books. Note that entries do not have to be a whole piece that incorporates each image (like the one below) - [INVESTIGATING THE CELLULAR MACHINERY: PROTEIN IDENTIFICATION](https://www.scq.ubc.ca/investigating-the-cellular-machinery-protein-identification/) - Proteins are the molecules that are responsible for the majority of functions inside the cell. Thus scientists are usually most interested in which proteins and how much of each protein are present in a cell following a particular experimental manipulation. Unfortunately, it is difficult to study global protein expression, since proteins cannot be replicated easily - [BITE BACK](https://www.scq.ubc.ca/bite-back/) - And there it is again. The painful experience resulting from foul teeth and the dawning realisation that another undesired visit to the dentist becomes inevitable. In the reality of shrill drilling sounds, affected humans of all ages tend to make a promise to take better care of their ivories after this surgery. However, once the - [FATHER AND DAUGHTER OR STEAM ENGINE TECHNOLOGY OF THE FUTURE: FUEL CELLS RUNNING ON ALCOHOLIC COCKTAILS](https://www.scq.ubc.ca/father-and-daughter-or-steam-engine-technology-of-the-future-fuel-cells-running-on-alcoholic-cocktails/) - "…rainy and a low of 2 …" kshhht "…climatologists meeting established a treaty that should further reduce CO2 exhausts by 20% over the next decade…" shh "…and here is their new song fresh from the producer…" kshhhh "…unprecedented flooding for this time of the year…" "Daaaa, could you please stop tweaking around on MY radio? - [RAMAN EFFECT](https://www.scq.ubc.ca/raman-effect/) - If you wish to make the color blue take a piece of sky and put it in a pot large enough to place on the flame of the horizon …And I left the recipe for whoever, one day, would imitate the sky. — Nuno Júdice Translated from the Portuguese by Richard Zenith River kites, with - [MALCOLM GLADWELL WRITES THE INTRODUCTION TO A NEW EDITION OF THE HITCHHIKER'S GUIDE TO THE GALAXY](https://www.scq.ubc.ca/malcolm-gladwell-writes-the-introduction-to-a-new-edition-of-the-hitchhikers-guide-to-the-galaxy-3/) - The galaxy is a very, very large place. And there's a lot less stuff in it than you might think. The late Douglas Adams was right to point out that, once stranded in it, the chances of someone offering you a ride in their roomy vehicle are vanishingly small. Previous editions of this book have - [ORDER OF THE SCIENCE SCOUTS OF EXEMPLARY REPUTE AND ABOVE AVERAGE PHYSIQUE](https://www.scq.ubc.ca/order-of-the-science-scouts-of-exemplary-repute-and-above-average-physique-2/) - anthem | topics | facebook | inkling * * * For the propagation of an ideal where science communicators can meet firstly, for drinks; secondly, for communicating; and ultimately, for networking. Joining is easy - please simply provide name with your city and a corresponding link (or more - we can take up to 3). - [LOVE IN THE LABORATORY](https://www.scq.ubc.ca/love-in-the-laboratory/) - It's that time of year again, when pie-eyed romantics are wont to wax rhapsodic about the nature, the essence, and the mystery of love. With gilded tongues and dubious poetic license, they fling around flawed analogies and sweeping generalizations like Cupid's arrows from a rapid-fire crossbow. And anyone with a heart beating within his or - [FOUNTAIN OF YOUTH EQUALS PHORPHYRA SP. (IT WOULDN'T HURT)](https://www.scq.ubc.ca/fountain-of-youth-equals-phorphyra-sp-it-wouldnt-hurt-2/) - The SCQ is happy to partake in the Week of Science initiative, and will have only textbook pieces for this particular week. If you need a breather, please take a moment to peruse our humour section. That should work nicely - - - INTRODUCTION The red algal Porphyra sp. is thought to be the single - [MALCOLM GLADWELL WRITES THE INTRODUCTION TO A NEW EDITION OF THE HITCHHIKER'S GUIDE TO THE GALAXY](https://www.scq.ubc.ca/malcolm-gladwell-writes-the-introduction-to-a-new-edition-of-the-hitchhikers-guide-to-the-galaxy/) - The galaxy is a very, very large place. And there's a lot less stuff in it than you might think. The late Douglas Adams was right to point out that, once stranded in it, the chances of someone offering you a ride in their roomy vehicle are vanishingly small. Previous editions of this book have - [BETWEEN A ROCK AND HARD PLACE](https://www.scq.ubc.ca/between-a-rock-and-hard-place/) - PLUTO: What do you mean you’re revoking my planetary status? BIG ROCK: Sorry, but effective immediately you’re a dwarf planet. DWARF PLANET FORMERLY KNOWN AS PLUTO: A dwarf planet? What the heck is that? BIG ROCK: No need for foul language. Dwarf planet’s a euphemism; it’s a nice way of saying Ice Ball. DWARF: Who - [FOUNTAIN OF YOUTH EQUALS PHORPHYRA SP. (IT WOULDN'T HURT)](https://www.scq.ubc.ca/fountain-of-youth-equals-phorphyra-sp-it-wouldnt-hurt/) - The SCQ is happy to partake in the Week of Science initiative, and will have only textbook pieces for this particular week. If you need a breather, please take a moment to peruse our humour section. That should work nicely - - - INTRODUCTION The red algal Porphyra sp. is thought to be the single - [ANYTIME](https://www.scq.ubc.ca/anytime/) - In some respects, a person reacting to the words “she’s in a coma” necessitates a cautioned approach. Is he kidding or is he serious? It’s akin to that feeling of discomfort you get when you’re not entirely sure if a woman is pregnant or just large. But to me, the phrase represents more than this - [MY NEW GRADUATE COURSE OFFERING](https://www.scq.ubc.ca/my-new-graduate-course-offering/) - Title: Introduction to My Research Area Course Instructor: Me T Th 10:30 -12:00, Willams 205 Office Hours: by appointment Course Syllabus: The course will consist of me, talking about my research area, for 15 weeks. Topics to be covered include: 1. My research area. 2. Why my research area is important. 3. Important contributions I - [ORGANIC FOODS - HEALTHY ALTERNATIVE OR JUST ANOTHER FAD?](https://www.scq.ubc.ca/organic-foods-healthy-alternative-or-just-another-fad/) - As more and more organic foods are appearing on the shelves of our grocery stores and are gaining publicity in mass media, one cannot help but wonder what the big deal is with the presence of the little green “organic” sticker. The word being passed around is that organic foods are “healthier” and “safer” for - [IF TREES COULD TALK](https://www.scq.ubc.ca/if-trees-could-talk/) - Q: So, Great Hemlock, you have been in this forest for a while, tell me what it was like back when you were a seedling. A: Ooh, that was 300 years ago, let me think. I remember looking up to see if I could locate my parents. There were many trees that shaded me from - [CREEPING INTO YOUR HEAD - A BRIEF INTRODUCTION TO MICROGLIA](https://www.scq.ubc.ca/creeping-into-your-head-a-brief-introduction-to-microglia/) - Know anyone with a brain? Know anyone with a problem with their brain? If you answered yes or no to either or both of those questions, you need to know about microglia. More importantly, however, you need to know about them in order to alleviate my distress. It's a sucking burden to over and over - [UNFORTUNATE CHAIN OF EVENTS LEADING UP TO PLUTO'S LOSS OF PLANETHOOD](https://www.scq.ubc.ca/unfortunate-chain-of-events-leading-up-to-plutos-loss-of-planethood/) - Pluto loses car keys Pluto steps in dog crap Pluto's July horoscope warns of "personal challenges ahead" Pluto's rent check bounces Pluto's Mustang suffers blown head gasket Pluto constantly late to work Pluto's girlfriend of three years leaves Pluto Pluto charged with solicitation of a prostitute Pluto becomes increasingly depressed Pluto seeks answers in a - [BIOFUELS AND THE PROSPECT OF CONVERTING PLANT FIBRES INTO GASOLINE USING ENZYMES](https://www.scq.ubc.ca/biofuels-and-the-prospect-of-converting-plant-fibres-into-gasoline-using-enzymes/) - Today, there is a significant interest in alternatives to fossil fuels. This has arisen given the increasing public concern over the environment as well as the general scientific consensus on the greenhouse effect caused by CO2 emissions. Consequently, any realization of a renewable energy source that is an effective alternative to gasoline and diesel would - [JOURNAL CLUB FIND: DNA = MUSIC, SERIOUSLY](https://www.scq.ubc.ca/journal-club-find-dna-music-seriously/) - As translated into musical notation REFERENCE: The all pervasive principle of repetitious recurrence governs not only coding sequence construction but also human endeavor in musical composition (1986) Susumi Ohno and Midori Ohno. Immunogenetics 24:71-78 ABSTRACT: Organisms which have evolved on this earth are governed by multitudes of periodicities; tomorrow is another today, and the next - [HOW THE SWISS INVENTED CIVILIZATION](https://www.scq.ubc.ca/how-the-swiss-invented-civilization/) - An unexpected archaeological find has led experts to a startling conclusion: Stonehenge, the ancient circle of stones in southern England, may have been built by the Swiss. This radical theory first took shape in 2003 when the grave of a Bronze Age archer was discovered about three miles from Stonehenge. Archaeologists concluded that the archer - [TELOMERASE](https://www.scq.ubc.ca/telomerase/) - Poem Oh, telomerase, You crafty soul, Whose life-giving phrase Like us, gets old Lets polymerase, With longlasting hold Yank out from our fate Our mortal coil Syllable Count 5 Oh, telomerase, 4 You crafty soul, 5 Whose life-giving phrase 4 Like us, gets old 5 Lets polymerase, 5 With longlasting hold 5 Yank out from - [PATHOGEN VIRULENCE: THE EVOLUTION OF SICKNESS](https://www.scq.ubc.ca/pathogen-virulence-the-evolution-of-sickness/) - Pathogens are disease-causing microorganisms whose negative effect on their host’s fitness can vary not only between host species, genotypes, and individuals but even between ecological circumstances and subpopulations (Dybdahl and Storfer, 2003). This reduction of host fitness, a highly sensitive characteristic dependent on numerous variables, is known as pathogenic virulence, and remains a topic of - [ROADSIDE](https://www.scq.ubc.ca/roadside/) - The guardrail arches its length against the road, a Jurassic spine. Clover has grown thick about its vertebrae where a rotting coon no longer warms the stones it hides, gives its eyes back to the earth. - [OF COURSE PROTEINS TALK TO EACH OTHER](https://www.scq.ubc.ca/of-course-proteins-talk-to-each-other/) - My first serious molecular biology course in college was entitled “DNA and Chromatin Structure” and there were only four students enrolled. While we were expected to take our best stabs at entertaining graduate level ideas, the class size made things inherently informal. One of our most common mistakes was the casual anthropomorphizing of molecular machinery. - [PUZZLE FANTASTICA #2: NUMBERS-MIRROR-INSTRUMENTS](https://www.scq.ubc.ca/puzzle-fantastica-2-numbers-mirror-instruments/) - We begin the new year with a puzzle to tempt you. The first PF was not solved, and was thereafter both lauded and criticized for its design (see below). This time, we are a little more deliberate, more designed, more clever - which we fear will also make it more simply. In any event, here - [A BRIEF HISTORY OF MY ON-GOING LOVE AFFAIR WITH SCIENCE](https://www.scq.ubc.ca/a-brief-history-of-my-on-going-love-affair-with-science-2/) - - FROM THE ARCHIVES - May 8th, 1988 I encounter science for the first time during recess. As my friends and I are busy using the magnifying lens that Billy Stewart had gotten for his eighth birthday to burn some sticks, she breaks off from the pack of girls she usually travels around the schoolyard - [MY MASSIVE ROBOTIC NASA ARM](https://www.scq.ubc.ca/my-massive-robotic-nasa-arm-2/) - - FROM THE ARCHIVES - 1 Went to the mall today. Bought some boxer briefs and an Icee. Stopped into the arcade and lost to some punk kid at Street Fighter II. It's hard for me to push the buttons at the right time. Shuttle Remote Manipulator Prostheses (SRMP) destroyed Street Fighter machine. 2 Saw - [LIMULUS & CHARLIE](https://www.scq.ubc.ca/limulus-charlie-2-2/) - - FROM THE ARCHIVES - Charlie wears broken glasses held together with tape and toothpicks. He is unemployed and occupies a one-bedroom apartment in Westchester, California, a half-mile northeast of LAX. Charlie eats in his car. His 1991 Nissan Stanza is a mausoleum of fast food, Frito Lay and Little Debbie wrappers. When Charlie was - [THE BIOTECH GAME OF LIFE](https://www.scq.ubc.ca/the-biotech-game-of-life-2/) - - FROM THE ARCHIVES - In "The Biotech Game of Life," which is similar to the Game of Life, each player is a scientist attempting to successfully bring his or her biotechnology product to the market. During the game, players will face many obstacles before obtaining a successful product and the first one to accomplish - [LIMULUS & CHARLIE](https://www.scq.ubc.ca/limulus-charlie-2/) - - FROM THE ARCHIVES - Charlie wears broken glasses held together with tape and toothpicks. He is unemployed and occupies a one-bedroom apartment in Westchester, California, a half-mile northeast of LAX. Charlie eats in his car. His 1991 Nissan Stanza is a mausoleum of fast food, Frito Lay and Little Debbie wrappers. When Charlie was - [WHITE COAT, WRONG TIME](https://www.scq.ubc.ca/white-coat-wrong-time-2/) - - FROM THE ARCHIVES - Imagine you’re at Starbucks. You’re halfway through a co-worker’s order (“half sweet, no foam, saffron-scented, opium-spritzed, …”) when two men wearing coveralls come in. You hear them talking about a car they’re fixing. Their garb has grease on it, various stains of indeterminate origin. They saunter up to the till, - [THE HOLIDAYS ARE NOT REALLY ABOUT SCIENCE](https://www.scq.ubc.ca/the-holidays-are-not-really-about-science-2/) - CHRISTMAS 1970. by Spike Milligan A little girl called Sile Javotte Said 'Look at the lovely presents I've got' While a little girl in Biafra said 'Oh what a lovely slice of bread'. - - - - - The SCQ wishes you a Happy Holidays, and invites you to please enjoy (or re-enjoy) some of - [A BIO-CHRISTMAS CAROL](https://www.scq.ubc.ca/a-bio-christmas-carol-2/) - - FROM THE ARCHIVES - Characters: Dr. Scrooge Young Scrooge Teen Scrooge Scrooge’s mother Dr. Jacob Marley Graduate Student Bob Cratchett Bob Cratchett’s wife Tiny Tina The Spirit of Christmas Past, a Developmental Biologist The Spirit of Christmas Present, a Biochemist The Spirit of Christmas Future, an Evolutionary Biologist Faculty member #1 Faculty member #2 - [IS THERE A SANTA?](https://www.scq.ubc.ca/is-there-a-santa-2/) - - FROM THE ARCHIVES - Being a scientific investigation of a cultural conundrum Soon it will be Christmas Eve, and once more children will be divided into distinct factions. Here, Cyr [1] described younger children (12 years) who have ditched this ‘childish’ belief. But he - [IT'S A WONDERFUL LAB](https://www.scq.ubc.ca/its-a-wonderful-lab/) - A 15 minute play, in 7 scenes. Characters Dr. Georgina Bailey Clarence (an angel) Jethro (a graduate student) ZuZu (another graduate student) Faculty member #1 Faculty member #2 Chairman of the Department Willie the bartender Car driver Angel #1/Child #1 Angel #2/Child #2 The set consists of four main areas: The lab: a small table, - [T'WAS THE NIGHT 'FORE THE CONFERENCE (A VISIT FROM SAINT AQUINAS)](https://www.scq.ubc.ca/twas-the-night-fore-the-conference-a-visit-from-saint-aquinas/) - With apologies to Clement Clarke Moore ’Twas the night ’fore the conference and all through the inn All the PIs were up with their laptops and pens, Making graphs and new slides for their talks the next day, In hopes that they’d have something brilliant to say. At the social, the party was raising good - [RANT FROM A GLACIER - CONCERNED, BITTER, AND SOMEWHERE NEAR THE NORTH POLE](https://www.scq.ubc.ca/rant-from-a-glacier-concerned-bitter-and-somewhere-near-the-north-pole/) - - FROM THE ARCHIVES - Dear humans everywhere: People. I’m melting. I’m actually melting. Are you not paying attention to what’s going on here? Are you not following the news? Are you just out and out disregarding the collected and heated but (get this) generally agreed upon advise from a whole bunch of experts? Is - [TO ROXANNE AND CYRAN06](https://www.scq.ubc.ca/to-roxanne-and-cyran06/) - spied you thrU my sitemeether lense bi nary bi noculars measure, for measure the traffic at my door all the way from Arroyo Grande C A looking for words you were to make her see fireworks in the sky of your fly on the Fourth of July jenny, jenny I've got your (ISP) number 24.180.3.105 no - [DESCENT OF DOG](https://www.scq.ubc.ca/descent-of-dog/) - Samson shivered in the early morning chill, jingling the chain joining his collar and leash. The sun was a big orange food bowl hanging low on the horizon, bathing the neighborhood in its warm glow. Most of the residents were still in bed at this hour, but a few dotted the sidewalks with their best - [TERRY'S WRITING CHALLENGE #2](https://www.scq.ubc.ca/terrys-writing-challenge-2/) - We thought perhaps (especially for those of you who are globally inclined) that you might enjoy a little writing contest we have going over at our sister site, Terry. Prizes consist of our bookstore's gift cards which are usable even for those of you who are not local (via their website). $1500 in total, and - [NEUROEROTICA](https://www.scq.ubc.ca/neuroerotica/) - "How do you feel?" she asked. "I'm not sure. Interested, but a bit tense maybe," said Brad, a thin man with short dark hair, sitting upright in a chair in Janet's office. Her test subject. Jotting down the last bit of demographic data, she put down her pen and studied him. The screening was complete - [KADATH: A VISION INTO THE AGE OF NANITES](https://www.scq.ubc.ca/kadath-a-vision-into-the-age-of-nanites/) - Many science fiction writers have developed tales regarding mankind’s attempts to surmount the forces of nature that separate man from God. These works often portray the human species as a newcomer to Earth and as a brash and shortsighted community working feverishly towards its own demise. The history of this story has its modern roots - [LIVING LA VIDA LOC(A): A BRIEF INSIGHT INTO THE WORLD OF "LAB ON A CHIP" AND MICROFLUIDICS](https://www.scq.ubc.ca/living-la-vida-loca-a-brief-insight-into-the-world-of-lab-on-a-chip-and-microfluidics/) - Throughout history, humans have always tried to improve the tools they use. Animals were bred to be larger, means of locomotion engineered to become more powerful, etc. Until recently, bigger was thought to be better. However, today it seems the opposite is true: Every day we experience pressure for buying smaller cameras, computers, cell phones, - [DOLLY REDUX](https://www.scq.ubc.ca/dolly-redux/) - The world mourned the passing of Dolly the cloned sheep in 2003, but the amiable ovine's contributions to science did not end with her death. After three years of trial and error, the Scottish researchers who made history by manipulating genes to produce Dolly have announced another breakthrough: the creation of the world's first clone-based - [THE NIGHT BEFORE AN ORGANIC CHEMISTRY EXAM](https://www.scq.ubc.ca/the-night-before-an-organic-chemistry-exam/) - Last night I had a dream in which I very nearly died; All round me raged a gruesome hoard of mad nucleotides. The sugars and the bases put the phosphates into flight, And SN2 reactions were occurring left and right. Then BF4 came sweeping in with hydride ions grim. From then on, all carbonyl groups - [ONCE UPON A TIME IN THE LAB: THE “REVIVARIN” STORY, WITH FIGURES](https://www.scq.ubc.ca/once-upon-a-time-in-the-lab-the-“revivarin”-story-with-figures/) - (See here first) Click here for larger view of image Once upon a time, I was working in lab late into the night. Late I say. So late that I was having trouble focusing both eyes in the same focal plane at the same time. Of course it also could have been from staring into - [AN ENGINEER IN BIOLOGYLAND](https://www.scq.ubc.ca/an-engineer-in-biologyland/) - “Biology? That’s unusual.” This is something I’ve been hearing a lot lately, usually from my friends when I tell them about the courses I’m taking this term. I’m in the home stretch of my Engineering Physics degree, which is the point where I’m supposed to choose some technical electives and become a specialist. Most Engineering - [A FABRICATED PAPER: DORIAN GRAY MICE - ON IMMORTAL MICE](https://www.scq.ubc.ca/a-fabricated-paper-dorian-gray-mice-on-immortal-mice/) - (This paper was presented as an April Fools Joke in Nature, 1993) TITLE: Dorian Gray Mice (by Robin A. Weiss) FIRST PARAGRAPH Newly generated transgenic mice appear to be able to grow indefinitely without ageing, yet with programmed death. This dramatic developmet is the work of several groups, and has been accomplished in three stages... - [HOT SCIENCE-Y GUY OF THE MONTH - JAMES DYSON](https://www.scq.ubc.ca/hot-science-y-guy-of-the-month-james-dyson/) - This month's Hot Science-y Guy really sucks. Okay, James Dyson doesn't suck, but his inventions sure as heck do. Just ask my friend, Bob, who recently purchased the Dyson Animal Model No. I-Don't-Know−Exactly-but-It's-a-Lovely-Shade-of-Purple. Oooh... a purple vacuum... And boy-oh-boy! I sure would like one of these bad boys for myself. And this time, when I - [THE SCIENCE CREATIVE QUARTERLY'S MOST EXCEPTIONAL, ILLUSTRIOUS, SPLENDIFEROUS HAIKU PHYLOGENY PROJECT](https://www.scq.ubc.ca/the-worlds-fair-and-the-science-creative-quarterly-together-in-the-most-exceptional-illustrious-splendiferous-challenge-of-the-second-half-of-june/) - Essentially, for a while, the SCQ has been interested in presenting a phylogeny related section, which would use some type of creative form as its driving force. And why not haikus (or is it Haiki?). So this is essentially a call for some Haiku's on various organisms, preferably ones that work in the phylogenetic context. - [HAIKU (AGAIN)](https://www.scq.ubc.ca/haiku-again/) - We have been getting some lovely haikus for our phylogeny project, and hope to continue getting more (need a good large data set to make this phylohaiku tree impressive looking). Anyway, here are some that work: THE NAIADS bottom of a row- boat, in a pool of rainwater, the mayflies orgy ~Nathan Smith BABY PENGUIN - [NOW THAT I'M A ROBOT](https://www.scq.ubc.ca/now-that-im-a-robot/) - Thank you all for coming. As you can clearly see, I'm no longer the person I once was. In fact, I'm no longer a person at all. Some may be tempted to call me an android. You'd be mistaken. An android is a robot with a human appearance, but when I got the chance to - [PRACTICAL COROLLARIES TO HEISENBERG'S UNCERTAINTY PRINCIPLE](https://www.scq.ubc.ca/practical-corollaries-to-heisenbergs-uncertainty-principle/) - The Cocktail Corollary No personal opinion may be freely expressed until a preliminary assessment of the listeners' related opinions has been completed. The Sartorial Corollary The fashion value of any wardrobe-related purchase cannot be measured by its originator. The Trailer Corollary A motion picture's true qualities cannot be measured until a ticket has been purchased, - [PAPAVER ARGEMONE](https://www.scq.ubc.ca/papaver-argemone/) - Original book source: Prof. Dr. Otto Wilhelm Thomé Flora von Deutschland, Österreich und der Schweiz 1885, Gera, Germany (see link for further details on image) - [SCIENCE AND SCIENCE EDUCATION IN THE SOUTH](https://www.scq.ubc.ca/science-and-science-education-in-the-south/) - A Call to the Scientist Amongst the readers of this article, there are many who are science lovers. Although, there are also interesting, intelligent, passionate people who don’t like science at all, a few of us exist who absolutely love science. The science lovers among us speak quietly and subtly to the rest of humanity - [CREATINE: FROM MUSCLE TO BRAIN](https://www.scq.ubc.ca/creatine-from-muscle-to-brain/) - Creatine is an organic molecule which was discovered in the first half of the nineteenth century, in meat extract resembling beef broth. A century later, in the first half of the twentieth century, another substance was found, this time in frog extract, being phosphocreatine - or creatine with a phosphate group stuck on it. It - [DAVE NG IS BOTH A SCIENTIST AND SOMEONE WHO WRITES NASTY REVIEWS ON BOOKS HE HASN’T ACTUALLY READ](https://www.scq.ubc.ca/dave-ng-is-both-a-scientist-and-someone-who-writes-nasty-reviews-on-books-he-hasn’t-actually-read/) - “Where The Heart Is” by Billie Letts. This book sucks. Why there is a picture of a house on the front cover escapes me, but let me save you the effort of reading this crap. Your heart is sort of in between your left and right lung. “Everything Is Illuminated” by Jonathan Safran Foer. I - [WHAT'S THE SCOOP? A QUANTITATIVE ANALYSIS OF KELLOGG'S RAISIN BRAN](https://www.scq.ubc.ca/whats-the-scoop-a-quantitative-analysis-of-kelloggs-raisin-bran/) - Advertisements for Kellogg's Raisin Bran indicate that there are two scoops of raisins in every box, and two plastic scoops, along with the words "Two scoops!", appear prominently on the front of the box. Unfortunately, a scoop is a nonstandard unit of volume, so the prevalence of raisins in the cereal remains uncertain. Moreover, Kellogg's - [LANGUAGE ACQUISITION AND "POOPIE"](https://www.scq.ubc.ca/language-acquisition-and-poopie/) - The way that human beings acquire the ability to understand and use language is a hotly contested scientific question. Often the various theories have fallen on either side of the usual nature/nurture divide: are human beings born with a built-in capability to use language? Or, do we learn most of our language use through interactions - [IN THE MATTER OF DR. K: A POEM CREATED SOLELY FROM PHRASES IN AN ATTORNEY’S LETTER OF APPLICATION FOR A US GREEN CARD FOR ONE OF MY FORMER STUDENTS, IN THE SAME ORDER AS THEY APPEAR IN THE LETTER.](https://www.scq.ubc.ca/in-the-matter-of-dr-k-a-poem-created-solely-from-phrases-in-an-attorney’s-letter-of-application-for-a-us-green-card-for-one-of-my-former-students-in-the-same-order-as-they-appear-in-the-letter/) - She is a research scientist of extraordinary ability, Her abilities are extraordinary and place her at an elite level of practice. She has managed to master numerous highly complex procedures that many in her field do not. She has distinguished herself from her peers by possessing great expertise in an almost unprecedented number of specialty - [LIKE, "-OMIC" GOD!](https://www.scq.ubc.ca/like-omic-god/) - Let us marvel at the proliferation of the term “ome”. First off – let’s define the term “-ome”. As near as I can tell, it means “whole” or “mass”. “-ome” takes into account the totality of a thing – it defines a field. Hence the “genome” is the sum of all genetic stuff and the - [PORTRAIT OF THE ARTIST AS A YOUNG SAPLING: TREES AS ARTISTS AND MOBILE ENTITIES](https://www.scq.ubc.ca/portrait-of-the-artist-as-a-young-sapling-trees-as-artists-and-mobile-entities/) - Image resulting from tree “painting” by Douglas-fir for two minutes. Trees epitomize immobility and passivity. They are rooted in one place, have extremely long lives relative to humans, and react slowly to most environmental stimuli, so both practically and symbolically, trees are closely linked with the related characteristics of stability, constancy, and permanence. The word - [EMBRYOLOGICAL ASPECTS AND ETIOLOGY OF CARCINOMA: GATEWAY TO THE CANCER STEM CELL THEORY](https://www.scq.ubc.ca/embryological-aspects-and-etiology-of-carcinoma-gateway-to-the-cancer-stem-cell-theory/) - At the outset of his 1902 publication in the Lancet, Dr. John Beard discloses that as an embryologist he is not the most socially licensed scientist to be proposing a theory regarding the etiology of cancer. He advises that it is the current protocol for this subject matter to be left to the surgeons and - [WHAT IF](https://www.scq.ubc.ca/what-if/) - Tired of waiting for more attention, the cat stretched, walked across the still form and up onto the table. It sniffed the shiny cylinders the man had used, and then stepped onto the machine into which the man had been speaking. Its curiosity satisfied, the feline jumped to the ground, but in doing so, a - [FIBONACCI POEMS](https://www.scq.ubc.ca/fibonacci-poems/) - (For more information about the Fibonacci numbers, please click here) Shyness Fish dive deeply, mouths agape, fins proud and ragged, filtering the oceans apart until shimmer-hooked and then flopping in boat bottoms, when gills heave, gasp, drowning in air; eyes glaze like dropped marbles, clouded and cracked, but holding. Ego She will nod as you - [CHASING A GHOST: UNRAVELLING THE SECRETS OF PHANTOM LIMB PAIN](https://www.scq.ubc.ca/chasing-a-ghost-unravelling-the-secrets-of-phantom-limb-pain/) - “For in and out, above, about, below, ‘Tis nothing but a Magic Shadow-show Play’d in a Box whose Candle is the Sun, Round which we Phantom Figures come and go.” -- The Rubâiyât of Omar Khayyâm We have been raised to believe in a concrete reality defined by matter, which is something that occupies space, - [JOURNAL CLUB FIND: SEXUAL ORIENTATION? LET'S LOOK AT YOUR FINGERS.](https://www.scq.ubc.ca/journal-club-find-sexual-orientation-lets-look-at-your-fingers/) - (Click on reference to see pdf of first page) REFERENCE: Finger-length ratios and sexual orientation. (2000) Nature 404: pp455-456 FIRST PARAGRAPH: Animal models have indicated that androgenic steroids acting before birth might influence the sexual orientation of adult humans. Here we examine the androgen-sensitive pattern of finger lengths, and find evidence that homosexual women are - [LUCY'S BONES FROM AFAR](https://www.scq.ubc.ca/lucys-bones-from-afar/) - Gracile Australopithecus: November 1974 Offered in atonement these few small bones meant nothing but salvation: a kind of anthropological grace held in a trembling hand. Mired in a bed of river dust pillowed between rocks and sheets of clay ancestral arthropods led us on. Before the fire we danced and drank and repeated the music - [GENE CLASSES FOLLOW DIFFERENT FATES AFTER PLANT GENOME DUPLICATION](https://www.scq.ubc.ca/gene-classes-follow-different-fates-after-plant-genome-duplication/) - Any student who has lost hours of work to a computer crash knows the value of backing up important files. Yet long before the first distraught student uttered shrieks of dismay at disappearing data, plants were saving an extra copy of certain genes—or so say Brad Chapman and his colleagues in a recent paper that - [MORE ASTRONOMICAL DEMOTIONS](https://www.scq.ubc.ca/more-astronomical-demotions/) - The sun is now called Macaca. The moon is referred to as The Infidel. The stars are to be known as Downtown Phoenix. The Big Bang is newly christened The Ring-a-Ding. The Milky Way is now the Skid Mark. The remaining planets collectively are renamed the G8. Please refer to planet Earth as 2Warm 4Al - [SUMAN](https://www.scq.ubc.ca/suman/) - Dirty scents excited her, the dirtier the better. When Alice announced this to the group of sense-photographers at the meeting for the new sensate advertising campaign, they all laughed. Who could have predicted that dirty things would bring in wealth? One of the men opened an illicit capsule of blue seal cigarette scent, and knuckles - [INTRODUCING OUR "FILTER"](https://www.scq.ubc.ca/introducing-our-filter/) - "FILTER" The name says it all really. The Science Creative Quarterly is, at the heart of it all, a project aimed at getting folks to talk a little more science. And if we were to expand this further, it is to get non-science folks to play a little as well. This, we've been doing in - [NO OTHER ILLNESS](https://www.scq.ubc.ca/no-other-illness/) - I am mentally ill. I have clinical depression. CD is a thoroughly miserable illness. I'm incredibly lucky to live at a time when CD like mine is easily treated by medication. Two pills every morning, and I'm myself again. The point of writing this isn't to tell the world that I've got clinical depression, or - [AMERICA AND ADIPOCYTES: WHY LIPOSUCTION IS NOT THE ANSWER](https://www.scq.ubc.ca/america-and-adipocytes-why-liposuction-is-not-the-answer/) - Roughly 65% of Americans are overweight, 23% are obese, and not surprisingly these numbers continue to rise.[1] There are three classifications of obesity as published by the World Health Organization (WHO) utilizing the body mass index (BMI) which is computed by dividing weight in kilograms by height in meters. [2] Individuals with a BMI greater - [FORMERLY KNOWN AS PLUTO](https://www.scq.ubc.ca/formerly-known-as-pluto/) - It's official. Pluto has resigned from the solar system. Citing the recent vote by the International Astronomical Union to change its status from planet to dwarf planet, the former ninth rock from the sun has responded with a firm "Thanks, but no thanks." First, a committee of astronomers came up with a new definition that - [A FABRICATED PAPER: FOLLOW YOUR NOSE - ON BIRDS FARTING AND STUFF](https://www.scq.ubc.ca/a-fabricated-paper-follow-your-nose-on-birds-farting-and-stuff/) - (This paper was designed by the author for a class assignment and as such is completely fabricated) TITLE: Follow your Nose FIRST PARAGRAPH Every bird examined to date has a fully functional olfactory system that is strikingly similar to the mammalian system. Also, many avian species are able to produce odour. However, researchers have struggled - [I.D. ON THE STAND](https://www.scq.ubc.ca/id-on-the-stand/) - A retelling of Kitzmiller vs. Dover Area School District,with apologies to Ernest L. Thayer The outlook wasn't brilliant 'neath that Pennsylvania sky: The courts stood N to zip before the new case here to try. Creationism in the schools had died a legal death, And now as Rothschild rose, Gishville IDers held their breath. The - [PREDICTABILITY IN THE GAME OF WAR](https://www.scq.ubc.ca/predictability-in-the-game-of-war/) - Appraise war in terms of the fundamental factors. —Sun Tzu The card game of war is typically considered a children’s game, as it requires no skill to play and minimal understanding of playing card relationships in a standard deck. With skill eliminated as a factor in determining the outcome, it is often assumed that war - [TUNA FISH: AN OVERVIEW](https://www.scq.ubc.ca/tuna-fish-an-overview/) - Bitten off More Small tin open like a fist is misleading. On the inside not a hair- bone bristles. Modern Ecology One day the housecats woke up enormous. Don’t know irony from goldfish said a large voice small-ly. The Melt The perfect union of lunch and sea, hot cheese stringing everything together. And the Cow - [WEATHER IS NOT A PEST](https://www.scq.ubc.ca/weather-is-not-a-pest/) - With summer past, I remember the flies and other assorted citizens of bugdom at my house. Some were silent like models of mathematical motion, and some buzzed loudly, almost as if you could see their pursed lips - air forced through their invertebrate skeletons. All seemed pervasive, as if to target my children endlessly whilst - [I AM HDL. HEAR ME ROAR](https://www.scq.ubc.ca/i-am-hdl-hear-me-roar/) - Dear Diary, What a day. Things are crazy at work. I have so much to do. It seems that Al’s high blood pressure, his decades of eating poorly, not exercising, being stressed out, and smoking like a chimney, is soon going to catch up with him. The fact that both his mom and his dad - [IS THERE SUCH A THING AS ISLAMIC SCIENCE? THE INFLUENCE OF ISLAM ON THE WORLD OF SCIENCE](https://www.scq.ubc.ca/is-there-such-a-thing-as-islamic-science-the-influence-of-islam-on-the-world-of-science/) - At present, when many think of the Middle East, the first word that comes to mind is oil, following close after unfortunately is war. However, the Middle East has a rich history in the development of science. Oddly enough, or perhaps not so strangely, Islam, the prominent religion of Middle Easterners, is intimately connected with - [COFFEE A LA MODE](https://www.scq.ubc.ca/coffee-a-la-mode/) - Similar visually to the mandala images, these are cups of coffee vibrating at (top) and near (bottom) a normal mode frequency - coffee a la mode. The resonance phenomenon shown in these coffee cup images is similar to Cymatics and Chladni patterns on a circular plate. Although the lines in Chaladni figures are nodes, the - [SPINAL INJURY: SO MANY WAYS TO STRIKE A CHORD](https://www.scq.ubc.ca/spinal-injury-so-many-ways-to-strike-a-chord/) - A hot summer afternoon in July 1994. Andy heads down the woodlands on his mountain bike, eager to get home and beat the heat with a few beers. A rainy day in March 1998, Stephanie stretches her legs in her Ford Explorer waiting to reach home after shopping for school clothes for her children. A - [DALE PECK REVIEWS EINSTEIN'S LATEST](https://www.scq.ubc.ca/dale-peck-reviews-einsteins-latest/) - Pedestrian crap. Albert Einstein's "General Theory of Relativity" (Annalen der Physik, Leipzig: Verlan Von Johann Ambrosius Barth, 1916) is crap. It's oblique, it's opaque, it's bloated with transparent effort. Salted, sanctimonious effort. I literally fidget turning the pages. Einstein is the worst physicist of his generation. Yet it goes deeper. He also grovels to the - [A WRITING CONTEST THAT CONCERNS IMAGES CHOSEN BY OUR SCIENCE WRITERS, AS WELL AS SOME MATHEMATICAL NOTATION](https://www.scq.ubc.ca/a-writing-contest-that-concerns-images-chosen-by-our-science-writers-as-well-as-some-mathematical-notation/) - PDF | JPG The Science Creative Quarterly seeks science humour pieces for entry into our awesome new contest. Judging will be based on a number of criteria that can be annotated as follows: Briefly, final Score (FS) is equal to the the base score of the humour piece submitted (S), times a number (n) of - [DUDE, YOU GOT SOME GUM?](https://www.scq.ubc.ca/dude-you-got-some-gum/) - When my family moved to Vancouver from Hong Kong, I was at the awkward age of 14. In addition to language barrier and social adjustment, most of my cultural shock came inevitably from high school. One thing that impressed me the most was how popular gum-chewing was (and still is). All these cool kids were - [THE RNA TIE CLUB AND LESSONS TO BE LEARNED IN HOW TO WIN A NOBEL PRIZE](https://www.scq.ubc.ca/the-rna-tie-club-and-lessons-to-be-learned-in-how-to-win-a-nobel-prize/) - As of November 2005, 776 Nobel Prizes have been awarded (758 to individuals, 18 to organizations) in physics, chemistry, medicine, literature, peace, and economics. In that same month, according to the U.S. Bureau of Census, there were an estimated 6,469,818,677 people alive in the world. Consequently, the average person (or even the average scientist) has - [WINNING PROJECTS FROM THE FELLOWSHIP BAPTIST CREATION SCIENCE FAIR 2001](https://www.scq.ubc.ca/winning-projects-from-the-fellowship-baptist-creation-science-fair-2001/) - Elementary School Level: 1st Place: "My Uncle Is A Man Named Steve (Not A Monkey)" Cassidy Turnbull (grade five) presented her uncle, Steve. She also showed photographs of monkeys and invited fairgoers to note the differences between her uncle and the monkeys. She tried to feed her uncle bananas, but he declined to eat them. - [TO TALK OF THE WORLD OF BODIES](https://www.scq.ubc.ca/to-talk-of-the-world-of-bodies/) - (BodyWorlds 3 is currently in Vancouver at Science World, until January 14, 2007) I had a train-wreck experience about Gunther von Hagens’ Body Worlds. I had previously heard nothing about the man, his work, or the show before we headed out to see it at Chicago’s Museum of Science and Industry, but one of my - [HOW EVOLUTION NATURALLY SELECTED ME](https://www.scq.ubc.ca/how-evolution-naturally-selected-me/) - If you’re anything like me you think Radiohead is the greatest band on the planet; that the Rolling Stones are important, but overrated; Natalie Portman is the greatest actress of her generation (and hot, even with short hair); the most disgusting noise is the noise of someone eating with their mouth open; and you read—a - [JOURNAL CLUB FIND: FORENSICS WITH A SPOON - NO WAIT, MAKE THAT ON A SPOON.](https://www.scq.ubc.ca/journal-club-find-forensics-with-a-spoon-no-wait-make-that-on-a-spoon-2/) - REFERENCE: The case of the disappearing teaspoons: longitudinal cohort study of the displacement of teaspoons in an Australian research institute. (2005) BMJ 331:1498-1500 ABSTRACT: OBJECTIVES: To determine the overall rate of loss of workplace teaspoons and whether attrition and displacement are correlated with the relative value of the teaspoons or type of tearoom. DESIGN: Longitudinal - [JOURNAL CLUB FIND: FORENSICS WITH A SPOON - NO WAIT, MAKE THAT ON A SPOON.](https://www.scq.ubc.ca/journal-club-find-forensics-with-a-spoon-no-wait-make-that-on-a-spoon/) - REFERENCE: The case of the disappearing teaspoons: longitudinal cohort study of the displacement of teaspoons in an Australian research institute. (2005) BMJ 331:1498-1500 ABSTRACT: OBJECTIVES: To determine the overall rate of loss of workplace teaspoons and whether attrition and displacement are correlated with the relative value of the teaspoons or type of tearoom. DESIGN: Longitudinal - [ON GLOBAL WARMING](https://www.scq.ubc.ca/on-global-warming/) - (This article was reprinted with permission from the edition of that finest of fine publications, n+1) Over the course of the past century, mean global temperatures increased by .6 degrees C. This change seems slight but isn’t: in the winter of 1905 my great-grandfather, a coppersmith, installed the roof on a new reef-point lighthouse two - [THE CROCODILE HUNTER BECOMES THE PLANET HUNTER](https://www.scq.ubc.ca/the-crocodile-hunter-becomes-the-planet-hunter/) - Dedicated to the man who was one of the funniest things, ever, on television, and we mean that in only the best of ways Cor Crikey! And g'day mate! Right now we're walking up to Hawaii's Gemini Observatory on the summit of Mauna Kea. It's got a beaut of a telescope inside, and we're hoping - [SONNETS FROM SPACE](https://www.scq.ubc.ca/sonnets-from-space/) - I We sit, in love and gazing at the stars That fill the violet evening sky with sparks. What flies up there, besides our thoughts, or larks That sing life's glory or its scars? Is there a being on a quest from Mars, And launching out in meteoric arcs? What answers would he seek when - [LET ME TELL YOU ABOUT JOHN MICHAEL GRIFFIN, JR.](https://www.scq.ubc.ca/let-me-tell-you-about-john-michael-griffin-jr/) - Griff, as he was known in high school, was a friend of mine. In fact, late in the first half of our lives, he stood up for me physically and philosophically, for being a science geek. Truth is, John's endorsement was the first time I was ever deemed cool for wanting to be a scientist. - [LET I = GLORIA GAYNOR](https://www.scq.ubc.ca/let-i-gloria-gaynor/) - In its initial state, I is a member of the set {afraid, petrified}. Hypothesis: U is a necessary condition for I. Under the initial assumptions, we may consider that IU == U, for values of I near 1 and large values of U. However, integrating the function I / (U multiplied by differential di/dm * - [SCIENCE AND ITS CREDIBILITY, THE 1960S VS. TODAY](https://www.scq.ubc.ca/science-and-its-credibility-the-1960s-vs-today/) - Science, according to John Ziman, past physicist, humanist, and author of Real Science, What it is, and What It Means (2000), states that “science is under attack.” In his book, he declares that: “People are losing confidence in its powers. Pseudo-scientific beliefs thrive. Anti-science speakers win public debates. Industrial firms misuse technology. Legislators curb experiments. - [IS THERE A NEUROCHEMICAL BASIS FOR FALLING IN LOVE?](https://www.scq.ubc.ca/is-there-a-neurochemical-basis-for-falling-in-love/) - Introduction “Nearly everybody gets twitterpated in the springtime. For example: You're walking along, minding your own business. You're looking neither to the left, nor to the right, when all of a sudden you run smack into a pretty face. You begin to get weak in the knees. Your head's in a whirl. And then you - [AN INTRODUCTION TO OCKHAM'S RAZOR](https://www.scq.ubc.ca/an-introduction-to-ockhams-razor/) - “Pluralitas non est ponenda sine necessitate” Ockham’s razor, states that the simplest explanation tends to be the right one. While the definition is straightforward, application of Ockham’s Razor requires some development. In this paper we are going to investigate the question, “How is simplicity to be determined?” Some philosophers and scientists have suggested that simplicity - [LOTIC](https://www.scq.ubc.ca/lotic/) - In electric confrontations, the clouds gather, grow dark, and grumble their dissent. They lumber about like gravid beasts, heavy bellies aimed at the earth below; a slow dance that lasts for days. Then, like a crescendo, it rains. Not an unusual phenomenon in this urban area of the west coast trapped between the mountains and - [IN WHICH OUR PROTAGONIST LEARNS THE IMPORTANCE OF THE BASE CASE](https://www.scq.ubc.ca/in-which-our-protagonist-learns-the-importance-of-the-base-case/) - I was three years old. By this point in my life, the residents of Sesame Street had educated me about as well as any community of puppets could reasonably be expected to educate any small child. Family legend has my father holding me, age fifteen months, as he selected an ice cream treat from the - [GRIZZLY BEARS TAKE NORTHERN VACATION](https://www.scq.ubc.ca/grizzly-bears-take-northern-vacation/) - (photographs by Mark Furze) A paw print, a hair, and a photograph are all clues that Canada’s grizzly bears are on the move. Recently, Canadian scientists genetically confirmed the sighting of a grizzly bear more than 1000 kilometers north of the species’ known range, proving that Canadians still have a lot to learn about our - [EINSTEIN AT PRINCETON](https://www.scq.ubc.ca/einstein-at-princeton/) - Einstein sits and thinks under the dark trees surrounding a white cottage — where no war came, even during the years when young men flooded out from this campus, cold from tap like the beer they’d drunk at the Tiger- town Inn just before their first induction. He stirs, but no amount of induction can - [SCIENCE GETS ITS FIRST SUPERMODEL](https://www.scq.ubc.ca/science-gets-its-first-supermodel/) - New discoveries that show evolution in action are causing some scientists to say that the first scientific supermodel has arrived. Biology is normally carried out within isolated specializations. Ecologists study one organism, molecular biologists another, while evolutionary biologists look over hundreds without probing too deeply into any particular one. But one tiny little fish, the - [HALF BAKED SCIENCE: A PRIMER ON MEDICINAL CANNABIS](https://www.scq.ubc.ca/half-baked-science-a-primer-on-medicinal-cannabis/) - Cannabis (marijuana) is among the most widely used of all psychoactive drugs. Despite the fact that its possession and use is illegal in most countries, cannabis is used regularly by as many as 25 million people in North America and Europe and by millions more in other parts of the world. There has been renewed - [CARTOON FEATURE: EINE KLEINE ZELLE](https://www.scq.ubc.ca/cartoon-feature-eine-kleine-zelle/) - A small cell, alone in the world, in the republic of cells.. The basic structure of life would not be nearly as interesting if it weren't for its ability to create more cells. If you think the "random" separations between cell cycle phases are about as tenuous to remember as the first 30 digits of - [WHITE LADY](https://www.scq.ubc.ca/white-lady/) - The animal I've been working with in my class lately is the beautiful beastie, Drosophila melanogaster. While I was cleaning out some stocks, I found this lovely example, a pale lady. She is a white mutant, and so lacks the normal red pigment in her eyes. In addition, she had just recently eclosed from her - [HEY BABY! I THINK OUR INTERACTION FUNCTIONS WOULD MESH WELL. LET'S DATE](https://www.scq.ubc.ca/hey-baby-i-think-our-interaction-functions-would-mesh-well-lets-date/) - A review of research by Dr. John Gottman at the University of Washington: “A General Systems Theory of Marriage: Nonlinear Different Equation Modeling of Marital Interaction”. J. Gottman, C. Swanson, K. Swanson. Personality and Social Psychology Review: 6(4), 326-340, 2002. ABSTRACT: This article describes a new mathematical approach for modeling the prediction of divorce or - [WATCHING THE BIRTH OF THE UNIVERSE: BOOK REVIEW: A SHORT HISTORY OF NEARLY EVERYTHING](https://www.scq.ubc.ca/watching-the-birth-of-the-universe-book-review-a-short-history-of-nearly-everything/) - A SHORT HISTORY OF NEARLY EVERYTHING By Bill Bryson. 544 pp. DoubleDay Canada $39.95 (Hardcover) I haven’t sat and watched this much television is years. But, it’s hard not to when the birth of the universe is on. And on my television, which gets only one channel with rabbit ears, it’s on every night. So, - [SWEATY SEX](https://www.scq.ubc.ca/sweaty-sex/) - Cameron Muir thinks a lot about hot, sweaty sex. It’s his job, after all. Muir is a psychologist at Brock University, and his current fascination is human sweat — particularly when it’s coitus-induced. His interest in sweat was aroused by steroid hormones, the tiny molecules like testosterone and estrogen that control so much of human - [SATIRE, SYRACUSE, AND SEA-LEVELS](https://www.scq.ubc.ca/satire-syracuse-and-sea-levels/) - I am an avid reader of The Onion. For those of you who don’t know what I’m talking about please be rest assured that I’m not some sort of weirdo who looks for messages in tea leaves and the like. Perhaps the name of a vegetable is a rather unusual choice for a satirical periodical, - [MYSTERY ORGANISM BAFFLES GIRL ADVENTURER.](https://www.scq.ubc.ca/mystery-organism-baffles-girl-adventurer/) - I’m a girl that likes to know what she’s looking at. I have a degree in biology, and I’ve spent the past few summers exploring Eastern North America, learning about the wildlife there. Those trips left me with an urge to identify every interesting plant, animal, or mineral I see, so that I can play - [OF EVOLUTION AND THE BIBLE](https://www.scq.ubc.ca/of-evolution-and-the-bible/) - In the Beginning… Many people believe that there is a conflict between science and religion when it comes to the question of how life began on Earth. While only a minority of people situate themselves squarely on one side of this debate, the topic tends to draw the attention of everyone. This is because the - [HIPPOPOTAMUS](https://www.scq.ubc.ca/hippopotamus/) - Many years ago, a hippopotamus decided to learn typing. As you may imagine, the task was difficult and discouraging. The hippopotamus however was unusually persistant. First she learned the parts of the typewriter, then she studied all available typing manuals, (even one for an antique which had neither name nor function in any western language; - [GOLDEN RICE: BACK ON THE BOIL?](https://www.scq.ubc.ca/golden-rice-back-on-the-boil/) - The genetically modified golden rice that was going to save the world in 2000, has yet to leave Louisiana, where it is being tested. Despite not having reached the countries it was expected to help, the rice with added vitamin A has been making waves among consumers and scientists alike. Farmers and research centers in - [PICK A NUMBER BETWEEN ZERO AND INFINITY...](https://www.scq.ubc.ca/pick-a-number-between-zero-and-infinity/) - From: dave@cogsci.indiana.edu (David Chalmers) Newsgroups: sci.math,sci.math.num-analysis Subject: Re: call for votes: most & least boring numbers Date: 17 Jan 90 20:40:02 GMT In article ain14924@merrimack.edu writes: "Reminds me of a friend of mine who claims that the number 17 is "the most random" number. His proof ran as follows: pick a number. It's not - [LEGAL RIGHTS AND THE MATERNAL-FETAL CONFLICT.](https://www.scq.ubc.ca/legal-rights-and-the-maternal-fetal-conflict/) - In 1973, the landmark and controversial court case Roe v. Wade came to a close when the U.S. Supreme Court ruled that a woman’s Constitutional right to privacy negated abortion legislation [1]. This court ruling enabled women to terminate pregnancies up to the point of fetal viability [2] (the point in fetal development at which - [HUNGER IN THE MIDST OF HIV](https://www.scq.ubc.ca/hunger-in-the-midst-of-hiv/) - New research suggests that British Columbians with HIV are more likely to be unsure of their next meal as compared to the rest of the Canadian population. This uncertainty is nearly 5 times higher than the general Canadian population, often leading to HIV- positive individuals not having access to adequate amounts of food. “We were - [INTRODUCTION TO PHYLOGENETICS.](https://www.scq.ubc.ca/introduction-to-phylogenetics/) - From the time of Charles Darwin, it has been the dream of many biologists to reconstruct the evolutionary history of all organisms on Earth and express it in the form of a phylogenetic tree. Phylogeny uses evolutionary distance, or evolutionary relationship, as a way of classifying organisms (taxonomy). Phylogenetic relationship between organisms is given by - [2ND LAW OF THERMODYNAMICS](https://www.scq.ubc.ca/2nd-law-of-thermodynamics/) - eyed with atlantic possibilities far beyond our sensibilities a depth so indigo starfalls time in a recycled surge and flow to obfuscate be wilder wisdom from such limited dimension (an inconceivable expanse of sea) by our gracefoolish linearity (onward ever we cycle persisting because a system can be ordered at the expense of disordering its - [THE GALLON CLUB](https://www.scq.ubc.ca/the-gallon-club/) - Today, when I gave blood, the petite, Hispanic technician informed me that I was now a member of the Gallon Club. She explained that I had made eight visits to the blood center over the years, and, having given eight pints, was now in the ranks. Opening a white file cabinet, she removed a gaudy - [DATING OILY ROCK](https://www.scq.ubc.ca/dating-oily-rock/) - The giant oil sands of Alberta finally have a date. And it’s a lot older than anyone expected. David Selby and Robert Creaser, from the University of Alberta, recently put an age of 112 ± 5.3 million years ago for the migration and accumulation of oil in the Alberta oil sands – a date over - [ASPARAGUS, STINKY PEE, AND SCIENTIFIC CURIOSITY](https://www.scq.ubc.ca/asparagus-stinky-pee-and-scientific-curiosity/) - I was recently enjoying a nice dinner with a few close friends of mine. Our conversations are often less than delicate, so it was no surprise that talk soon became a little tactless. The subject turned to the unpleasant yet inevitable consequences of our meal that would visit each of us within a few hours. - [DEATH: AN INTERDISCIPLINARY ATTEMPT AT A DEFINITION](https://www.scq.ubc.ca/death-an-interdisciplinary-attempt-at-a-definition/) - (1: Holding the Tail) The mouse is shaking his head and tail as if he is saying no, no, no. Honest, he is. Yesterday, I couldn’t do the mouse in, but that was yesterday. I’ve learned to do other things that I didn’t enjoy. Annihilating a mouse is a yet another one of those unpleasantaries, - [THE GIRAFFE: A FAVOURITE TEXTBOOK ILLUSTRATION OF EVOLUTIONARY THEORIES](https://www.scq.ubc.ca/the-giraffe-a-favourite-textbook-illustration-of-evolutionary-theories/) - High-school biology texts regularly present Darwin’s theory of evolution in contrast with Lamarck’s earlier explanation, and the organism most often used to illustrate the difference between the two views is the giraffe (e.g., Creager et al., pp. 233-240). Lamarck, it is said, told a story of giraffe necks becoming longer as the animals tried to - [RESURRECTING DAMAGED NEURONS: ARE WE FIGHTING A HOPELESS BATTLE?](https://www.scq.ubc.ca/resurrecting-damaged-neurons-are-we-fighting-a-hopeless-battle/) - Spinal cord injury (SCI) has been documented throughout history. Early physicians described patients with this affliction to be conscious and aware yet unable to innervate their limbs. Up to the mid 1960s the proper course of treatment for SCI was to stabilize the spinal cord to avoid further injury. Repair, however, was deemed impossible. It - [CHILD'S PLAY](https://www.scq.ubc.ca/childs-play/) - My brother sent me a subscription to the British magazine New Scientist last Christmas. I love it. It arrives once a week and sits, like a center piece, in the middle of the kitchen table. Everyone in the family takes turns reading it, each finding, at different times during the week—over coffee and toast, before - [THE COMPASSES OF BIRDS](https://www.scq.ubc.ca/the-compasses-of-birds/) - Twice a year, arctic terns make an epic journey. They travel the length of the Earth, from breeding grounds in the high Arctic to their southern habitat in Antarctica and back—a one-way distance of almost 20,000 kilometres[1]. This migratory pattern allows terns to follow their food, and escape extreme winters at both ends of the - [IMPERATIVE AND INDIFFERENCE.](https://www.scq.ubc.ca/imperative-and-indifference/) - Like some animal licking matted fur, the softness of the tongue on the softness of the wound. The sum of the wounds is a ball that expands according to its own clock, whenever it damn well pleases. Asserts itself always at the beginning of the day, I wake up to it, chattering its bad news - [SIX DEGREES OF BEING SMALL.](https://www.scq.ubc.ca/six-degrees-of-being-small/) - The medieval followers of Aristotle, first in the Islamic world and then in Christian Europe, tried to make sense of the moon. It was suggested in Antiquity that the moon was a perfect mirror; its markings were reflections of earthly features. On Sunday July 16th 2000, the longest-lasting lunar eclipse in 140 years was said - [IN THE NAME OF FAIR GAME...](https://www.scq.ubc.ca/in-the-name-of-fair-game/) - Doping to enhance athletic performance happens at every level of the game; lately, we have heard about it in professional baseball, at the Olympics, at other international competitions and even at our local gyms. Performance pressure is ever increasing, especially considering the financial endorsements and sponsorships associated with success. As a consequence, some athletes continue - [SIZE MATTERS: THE IMPENDING DEATH OF THE Y CHROMOSOME](https://www.scq.ubc.ca/size-matters-the-impending-death-of-the-y-chromosome/) - “And the LORD God caused a deep sleep to fall upon Adam, and he slept: and he took one of his ribs, and closed up the flesh instead thereof; And the rib, which the LORD God had taken from man, made he a woman, and brought her unto the man. And Adam said, This is - [THANKS FOR ALL THE BLOOD](https://www.scq.ubc.ca/thanks-for-all-the-blood/) - Blood donors around the world got a pat on the back last week, as the World Heath Organization (WHO) stamped June 14 “World Blood Day.” Everyday millions of people feel the jab of a donation needle, giving pints of blood that can help save lives, and last Tuesday was a chance to reflect on this - [SEXY UNIVERSE](https://www.scq.ubc.ca/sexy-universe/) - You are fine, what did you say your name is again? Mm. You got a way aboutcha, no lie. I like the way you cuuuuuuuurve so seductively around massive objects, baby, and I am dying to see how much you curve around this. You give me different looks, I like that, always something new to - [HOLLYWOOD VS. SCIENCE: HOW FAR ARE WE FROM INTERSTELLAR TRAVEL?](https://www.scq.ubc.ca/hollywood-vs-science-how-far-are-we-from-interstellar-travel/) - Virtually all Hollywood science fiction - from Star Trek to Total Recall to the Alien franchise - agrees on one basic point: sometime in the near future, humanity will soup up its spaceships, stock them with silver jumpsuits, and get itself beyond the confines of our solar system. So, in no time at all, humanity - [THE YEAST TWO-HYBRID ASSAY: AN EXERCISE IN EXPERIMENTAL ELOQUENCE](https://www.scq.ubc.ca/the-yeast-two-hybrid-assay-an-exercise-in-experimental-eloquence/) - (August, 2003) Once upon a time, it was believed that proteins were isolated entities, floating in the cytosol and, for the most part, acting independently of surrounding proteins. Proteins were thought to diffuse freely, and reactions occurred as a result of proteins A and B randomly colliding with one another. Today we know this picture - [THE CELL CYCLE: A UNIVERSAL CELLULAR DIVISION PROGRAM](https://www.scq.ubc.ca/the-cell-cycle-a-universal-cellular-division-program/) - (August 2003) In the 17th century, Robert Hooke peered through a microscope at a slice of cork and discovered that it was composed of cells1. Centuries later, Rudolf Virchow set forth the cell theory1, in which he proposed that the cell was the basic unit of all living organisms. We now know that this theory - [DOLPHINS SHOW SOME CULTURE](https://www.scq.ubc.ca/dolphins-show-some-culture/) - See a dolphin swimming through the water and you’re not just looking at a sleek and playful marine creature, you’re also seeing an animal with culture. Indeed, dolphin culture has recently been spotted off the coast of Australia, says new research from a group of international marine biologists studying bottlenose dolphins. However, this dolphin culture - [MICROBIAL FUEL CELLS FROM RHODOPHERAX FERRIREDUCENS](https://www.scq.ubc.ca/microbial-fuel-cells-from-rhodopherax-ferrireducens/) - Novel microbial fuel cells. A recently isolated microorganism has been reported to have a remarkable potential for electricity generation in microbial fuel cells. Rhodoferax ferrireducens, an iron-reducing microorganism, was isolated from subsurface sediments in Oyster Bay, Virginia, USA. Microbial fuel cells composed of this microorganism exceed the performance of previously described microbial fuel cells and - [RESTRICTION ENDONUCLEASES: MOLECULAR SCISSORS FOR SPECIFICALLY CUTTING DNA](https://www.scq.ubc.ca/restriction-endonucleases-molecular-scissors-for-specifically-cutting-dna/) - (August 2003) Today, in the age of molecular biology, the study of an organism's genome (its complete DNA) is a central component driving our understanding of biology. When scientists first considered studying genomes they were faced with a problem: how to reproducibly cut a genome's DNA into fragments that were small enough to handle? It - [A BRIEF TOUR OF DNA FINGERPRINTING](https://www.scq.ubc.ca/a-brief-tour-of-dna-fingerprinting/) - (August, 2003) Although the structure of DNA is the same throughout all species of plants, animals and microorganisms, each individual organism looks different. This is due to the order in which DNA base pairs are sequenced. Not only does this order make you a human rather than a dog or a daffodil, it also makes - [SOME VENN DIAGRAMS](https://www.scq.ubc.ca/some-venn-diagrams/) - * * * * * * * * * * * * * * * (REPRINTED FROM ISSUE TWO, JULY 25th, 2005) - [BOMBYX DISPAR](https://www.scq.ubc.ca/bombyx-dispar/) - If you were to base a character on the moth called Bombyx dispar you could easily set your story in Count Wodzicki's garden 1848 Your Bombyx could attach him or her upsidedown on Wodzicki's trees contained in a hairy envelope just one egg among others Then Wodzicki, I don't know if he's good or bad, - [SYSTEMS BIOLOGY: AN OVERVIEW](https://www.scq.ubc.ca/systems-biology-an-overview/) - Milestones in DNA research The discovery of DNA structure in 1953 was the starting point of a real scientific and cultural revolution, the ending of which is difficult to predict. The discovery and use of enzymes that copy, cut and join DNA molecules in cells was the next step in this revolutionary course. The development - [JOURNAL CLUB FIND: YOU WANT FRIES WITH THAT?](https://www.scq.ubc.ca/journal-club-find-you-want-fries-with-that/) - REFERENCE: In Vitro-Cultured Meat Production. (2005) P.D. Edelman, D.C. McFarland, V.A. Mironov, and J.G. Matheny. Tissue Engineering 11: p659 ABSTRACT: Although meat has enjoyed sustained popularity as a foodstuff, consumers have expressed growing concern over some consequences of meat consumption and production. These include nutrition-related diseases, foodborne illnesses, resource use and pollution, and use of - [A MONK'S FLOURISHING GARDEN: THE BASICS OF MOLECULAR BIOLOGY EXPLAINED](https://www.scq.ubc.ca/a-monks-flourishing-garden-the-basics-of-molecular-biology-explained/) - (August, 2003) The first inklings of genetic theory can be traced back to a common human experience: the recognition that a child has features similar to those of its parents. This ancient observation is actually one of the cornerstones of genetics and its subsequent offspring, molecular biology. For centuries there was little evidence beyond the - [STUDYING GENE FUNCTION: CREATING KNOCKOUT MICE](https://www.scq.ubc.ca/studying-gene-function-creating-knockout-mice/) - (August 2004) Construction a knockout mouse For decades researchers have tried to create tools that allowed for precise control over a specific gene in order to study its function. In the early 1980's a breakthrough technology known as transgenics or gene transfer was developed [1]. This new technology involved the process of pronuclear microinjection, a - [REVIEW OF "YOUR DISGUSTING HEAD"](https://www.scq.ubc.ca/review-of-your-disgusting-head/) - YOUR DISGUSTING HEAD: THE DARKEST, MOST OFFENSIVE - AND MOIST - SECRETS OF YOUR EARS, MOUTH AND NOSE. By The Haggis-On-Whey World of Unbelievable Brilliance. 64pp. Simon and Schuster $24.50 (Hardcover) In Norway, you say “buse.” As a geneticist, I am a lot more familiar with the concept of snot than one might suspect. And - [WEALTH AS A CANCER RISK](https://www.scq.ubc.ca/wealth-as-a-cancer-risk/) - Wealth can bring a lot of things to a family and new research is suggesting such things are not always good. One of these is childhood leukemia. Although rare overall, leukemia is one of the most common potentially fatal illnesses that can befall a child, and a new study completed at the BC Cancer Agency - [SHORTSTOP PROVIDES HUNTINGTON'S CLUES](https://www.scq.ubc.ca/shortstop-provides-huntingtons-clues/) - A debate is going on in Huntington’s research about whether the hallmark protein aggregates found in the brain of patients actually cause the disease. Now, a new “shortstop” may have found part of the answer. But this shortstop isn’t an infielder. It’s a new strain of mouse, one with a mutation expected to cause neurodegeneration - [ANTISENSE RNA](https://www.scq.ubc.ca/antisense-rna/) - (August 2003) Messenger RNA (mRNA) is a single stranded molecule that is used as the template for protein translation. It is possible for RNA to form duplexes, similar to DNA, with a second sequence of RNA complementary to the first strand. This second sequence is called antisense RNA (Figure 1). The formation of double stranded - [THE BIG BAD BAC: BACTERIAL ARTIFICIAL CHROMOSOMES](https://www.scq.ubc.ca/the-big-bad-bac-bacterial-artificial-chromosomes/) - (August 2004) Genetic Carrying Handles: Cloning Vectors In order to clone a gene, its DNA sequence must be attached to some kind of carrier, also made of DNA, that can take it into the cell. Biologists call these carriers vectors. A vector acts like a handle for the DNA, and it also contains other tools - [BT CORN: IS IT WORTH THE RISK?](https://www.scq.ubc.ca/bt-corn-is-it-worth-the-risk/) - Bt corn, a genetically modified organism (GMO), has been both the poster-child and thorn-in-the-side of the plant biotechnology industry from the late 1990’s to present. There are several versions of this transgenic crop that each have a gene from an insect pathogen, Bacillus thuringiensis (Bt), which encodes a protein toxic to the European corn borer - [EVOLUTION OF ALCOHOL SYNTHESIS](https://www.scq.ubc.ca/evolution-of-alcohol-synthesis/) - We need to appreciate beer more. Alcohol has a long history in human affairs, and has been important in purifying and preserving food and drink, and in making our parties livelier. We owe it all to a tiny little microorganism, Saccharomyces cerevisiae, which converts complex plant sugars into smaller, simpler, more socially potent molecules of - [POEMS](https://www.scq.ubc.ca/poems/) - The Big Picture* The man on the radio is speaking of his specialty and passion, theoretical astrophysics. The interviewer frets the big ones, wants to know what is there, on the other side of the end of the universe. Wants to know what it was was then before the Big Bang happened. I've heard these - [SPOT YOUR GENES - AN OVERVIEW OF THE MICROARRAY](https://www.scq.ubc.ca/spot-your-genes-an-overview-of-the-microarray/) - (August 2004) A cell functions by using its genes to produce proteins and although each cell within an organism will usually contain the same set of genes, there are significant differences in which genes are activated and how they are controlled. This is idea is easy to digest when you think about how a single-celled - [MASS SPECTROMETRY](https://www.scq.ubc.ca/mass-spectrometry/) - (August 2004) Development of mass spectrometry began with J.J. Thomson's vacuum tube, with which, in the early part of the 20th century, he demonstrated the existence of electrons and "positive rays." Thomson observed that the new technique could also be used by chemists to analyze chemicals. Despite this far-sighted observation, the primary application of mass - [THAWING OUT NORTHERN MAMMALS](https://www.scq.ubc.ca/thawing-out-northern-mammals/) - For mammals in the northern regions of the world, global warming must seem a little more real than it does to humans below the Arctic Circle. In 2004, the Arctic Climate Impact Assessment released a report called Impacts of a Warming Climate that revealed dire and immediate consequences of climate change for species ranging from - [ISLET AMYLOID - A CULPRIT IN TYPE 2 DIABETES](https://www.scq.ubc.ca/islet-amyloid-a-culprit-in-type-2-diabetes/) - It is estimated that nearly 194 million people worldwide have diabetes. This is an increase from the 1995 global estimation of 135 million which was published in a World Health Organization study in 1998[1]. The International Diabetes Federation reconfirms that type 2 diabetes, which is the non-insulin dependent type, constitutes about 85% to 95% of - [DNA RESTRICTION DIGEST AND GEL ELECTROPHORESIS: A VIRTUAL LAB](https://www.scq.ubc.ca/dna-restriction-digest-and-gel-electrophoresis-a-virtual-lab/) - - Click here to launch virtual lab - (Screenshot #1) This is the virtual version of the UBC Advanced Molecular Biology Laboratory's experimental kit #2 (see Restriction Digest of Lambda DNA and Gel Electrophoresis for details) which features a common and important molecular technique used in laboratories to analyze DNA. This molecular technique can be - [FLOW CYTOMETRY: A TECHNOLOGY TO COUNT AND SORT CELLS](https://www.scq.ubc.ca/flow-cytometry-a-technology-to-count-and-sort-cells/) - (August, 2003) Flow cytometry is a technology that allows a single cell to be measured for a variety of characteristics, determined by looking at how they flow in liquid [1]. Instruments used for this can gather information about cells by measuring visible and fluorescent light emissions, allowing cell sorting based on physical, biochemical and antigenic - [CONFOCAL MICROSCOPY - A VISUAL SLICE OF THE CELLULAR WORLD](https://www.scq.ubc.ca/confocal-microscopy-a-visual-slice-of-the-cellular-world/) - (August, 2004) Seeing a cell is an essential aspect of cell biology. To the small world of the cell, confocal microscopy is a major advance upon normal light microscopy since it allows one to visualize not only deep into cells and tissues, but to also create images in three dimensions [1]. There are many aspects - [JOURNAL CLUB FIND: I CHOOSE BURGER 'B'](https://www.scq.ubc.ca/journal-club-find-i-choose-burger-b/) - REFERENCE: Potential Effects of the Next 100 Billion Hamburgers Sold by McDonald's. (2005) American Journal of Preventive Medicine 28(4) :379-381 ABSTRACT: Background: McDonald’s has sold more than 100 billion beef-based hamburgers worldwide with a potentially considerable health impact. This paper explores whether there would be any advantages if the next 100 billion burgers were instead - [BIOPROSPECTING: A NEW WESTERN BLOCKBUSTER, AFTER THE GOLD RUSH, THE GENE RUSH](https://www.scq.ubc.ca/bioprospecting-a-new-western-blockbuster-after-the-gold-rush-the-gene-rush/) - Picture a group of scientists exploring tropical forests to collect plants, fungi or microorganism samples. They are bioprospecting. In other words, they are looking for new compounds that may help remediate so-far incurable diseases. Picture them settling in villages and discussing with the shaman to learn their traditional way of using plants to heal their - [A BRAKE ON THE EVER EXPANDING GENOME](https://www.scq.ubc.ca/a-brake-on-the-ever-expanding-genome/) - Want to expand a genome? Previous thinking suggests you only need some transposable elements, often nicknamed “jumping genes”, to repeatedly, and irreversibly, insert into the genome. Time will take care of the rest. However, new research is now challenging this view by revealing that transposable elements can also be deleted during evolution. The new findings - [COMPOSURE](https://www.scq.ubc.ca/composure/) - On page 1420 of the old Second Edition Webster’s Unabridged my father bought over 20 years ago for my brothers and me, it states that in music, a prelude is an introductory section or movement of a suite or fugue, and that since the 19th century it has become any short romantic composition. I was - [DNA FINGERPRINTING IN THE STANDARDIZATION OF HERBS AND NUTRACEUTICALS](https://www.scq.ubc.ca/dna-fingerprinting-in-the-standardization-of-herbs-and-nutraceuticals/) - (August 2004) Deoxyribonucleic acid (DNA) is the fundamental building component of all living cells. Our characteristics, traits and physical features are determined by the specific arrangement of DNA base-pair sequences in the cell. It is this distinct arrangement of adenine, guanine, thymine and cytosine (called DNA nucleotides) that regulates the production of specific proteins and - [TARGETING YOUR DNA WITH THE CRE/LOX SYSTEM](https://www.scq.ubc.ca/targeting-your-dna-with-the-crelox-system/) - (August 2004) It has been 15 years now that the Cre/lox system has been used as a way to artificially control gene expression. If your radar hasn't picked it up yet, you're missing out on a clever way to move pieces of DNA around in a cell. Over the years, this system has allowed researchers - [CHANGING THE LANGUAGE OF DNA](https://www.scq.ubc.ca/changing-the-language-of-dna-2/) - (August 2005) DNA is the genetic code of life, a sort of molecular instruction manual that is passed on from mother to daughter cell. This set of instructions is read by the cell and translated into proteins, which perform specific functions within the cell. The DNA molecule itself is made up of a linear sequence - [GENETICS OF SEX AND GENDER IDENTITY](https://www.scq.ubc.ca/genetics-of-sex-and-gender-identity/) - (August 2004) Genetics and sex determination Genetics is defined as the study of genes. Genes are composed of deoxyribonucleic acid (DNA) that can be passed down and inherited from one generation to the next. The information encoded in DNA is critical for determining the properties of a species1. DNA is divided into discrete molecules called - [THE GENETIC BASIS OF INTELLIGENCE](https://www.scq.ubc.ca/the-genetic-basis-of-intelligence/) - (August 2004) Intelligence is a very difficult concept to define. Intellect is described as "the power of the mind to think in a logical manner and acquire knowledge" [1]. Even psychology experts have not agreed upon what this actually means [2]. Intelligence can be divided into various subcategories such as reasoning, problem solving, and memory, - [POLYMERASE CHAIN REACTION](https://www.scq.ubc.ca/polymerase-chain-reaction/) - (August 2003) The Polymerase Chain Reaction (PCR) is an important tool for many applications. For example, it can be used to amplify a sample of DNA when there isn't enough to analyze (e.g. a sample of DNA from a crime scene, archeological samples), as a method of identifying a gene of interest, or to test - [IDENTIFYING DNA, RNA AND PROTEINS: THE BLOTS](https://www.scq.ubc.ca/identifying-dna-rna-and-proteins-the-blots/) - (August 2003) The separation of DNA/RNA fragments or a protein sample based on size can be useful in many applications, but visualizing samples on a gel does not give any information about the identity of the sample (i.e. which gene fragment, mRNA or protein you are looking at). So how can you pick out the - [PAINLESS GENE EXPRESSION PROFILING: SAGE (SERIAL ANALYSIS OF GENE EXPRESSION)](https://www.scq.ubc.ca/painless-gene-expression-profiling-sage-serial-analysis-of-gene-expression/) - (August 2004) With the advent of the human genome project, a vast amount of information about genes and gene structure is suddenly at our fingertips. But this information is limited. Every cell within an organism has the same genetic composition (with the exception of its gametes), and yet, obviously skin tissue is very different from - [GENETIC STUDIES OF AGING AND LONGEVITY IN MODEL ORGANISMS](https://www.scq.ubc.ca/genetic-studies-of-aging-and-longevity-in-model-organisms/) - (August 2004) Aging can be characterized as: (1) an inevitable consequence of being a multicellular organism; (2) associated with a random, passive decline in function; (3) leading to a global loss of homeostasis (the state of sustained equilibrium in which all cells, and all life forms, exist) over time; and (4) mortality increasing with age - [PREIMPLANTATION GENETIC DIAGNOSIS AND OUR FUTURE: SHOULD WE BE PEERING INTO THE WOMB?](https://www.scq.ubc.ca/preimplantation-genetic-diagnosis-and-our-future-should-we-be-peering-into-the-womb/) - (August 2003) "Those who cannot remember the past are condemned to repeat it." — George Santayana "In the realm of bioethics, the evils we face are intertwined with the goods we so keenly seek. Distinguishing good and bad thus intermixed is often extremely difficult." — Leon R. Kass MD, PhD Chairman, The President's Council on - [THE BUSINESS OF BIOTECHNOLOGY](https://www.scq.ubc.ca/the-business-of-biotechnology/) - (August 2004) Beer was created in 2000 B.C. when Egyptians first discovered how to ferment yeast. In 500 B.C., the Chinese invented a crude antibiotic from moldy soybeans curds and used it treat boils. These discoveries indicate an early human awareness of biology's usefulness in creating medical and agricultural advances and for over four thousand - [FOOD MICROBIOLOGY: THE BASICS AND THE DETAILS OF CHEESE PRODUCTION](https://www.scq.ubc.ca/food-microbiology-the-basics-and-the-details-of-cheese-production/) - (August 2003) Food spoilage has been an important problem throughout human history. Finding ways to overcome this problem was crucial as communities became larger and individuals no longer grew their own food. Some kind of system was needed to maintain the nutrient content of various food stuffs for long periods of time and prevent them - [STEM CELL BIOENGINEERING](https://www.scq.ubc.ca/stem-cell-bioengineering/) - (August 2004) Stem cells have generated more excitement, scrutiny and controversy than any other area of recent scientific study. The first stem cells, which were discovered half a century ago, were isolated from blood. Now, scientists around the globe are researching various types of stem cells for their potential to regenerate lost tissue and revolutionize - [BIOMIMICRY/BIMIMETICS: GENERAL PRINCIPLES AND PRACTICAL EXAMPLES](https://www.scq.ubc.ca/biomimicrybimimetics-general-principles-and-practical-examples/) - (August 2004) Design solutions can draw inspiration from many sources, including the anatomy, physiology, and behaviour of living systems. For instance, many Aboriginal Alaskans stalk seals in a similar fashion to the way polar bears hunt the smaller marine mammals [1]. Industry also imitates nature: Joseph Paxton used the structure of a lily pad as - [MAKING NATURE WORK FOR YOU: AN INTRODUCTION TO BIOTECHNOLOGY](https://www.scq.ubc.ca/making-nature-work-for-you-an-introduction-to-biotechnology/) - (August 2004) Biotechnology is the application of scientific and engineering principles to process biological materials for goods and services. Biotechnology is, therefore, highly multidisciplinary with foundations in many fields including cell and molecular biology, physiology, immunology, microbiology, genetics, biochemistry and chemical and process engineering. Figure 1. The biotechnology tree. Biotechnologists uses techniques derived from a - [GENETICALLY MODIFIED FOODS](https://www.scq.ubc.ca/genetically-modified-foods/) - (August 2004) Generally, this term refers to food crops that have been altered using a variety of molecular biology techniques in order to provide them with either new or enhanced characteristics. Examples of such enhancements of modifications are herbicide tolerance, pesticide resistance, greater nutritional content or increased tolerance of cold temperatures. Genetically modified organisms (GMOs) - [CELL CULTURE](https://www.scq.ubc.ca/cell-culture/) - (August 2004) Animal or plant cells, removed from tissues, will continue to grow if supplied with the appropriate nutrients and conditions. When carried out in a laboratory, the process is called Cell Culture. It occurs in vitro ('in glass') as opposed to in vivo ('in life'). The culture process allows single cells to act as - [THE LITTLE WORKERS OF THE MINING INDUSTRY](https://www.scq.ubc.ca/the-little-workers-of-the-mining-industry/) - Advocates of biotechnology have consistently upheld the notion that the field contributes to human health care, environmental protection, and industrial-scale synthesis of complex chemicals. Despite the obvious importance of these areas, biotechnology also has much to offer to other fields. One of the oldest of these is the mining industry. The earliest use of microbial - [THE UNACKNOWLEDGED WORKERS OF THE BIOTECHNOLOGY INDUSTRY: MICROBES](https://www.scq.ubc.ca/the-unacknowledged-workers-of-the-biotechnology-industry-microbes/) - (August 2003) Although seen by many as a development of the 20th century, biotechnology was, in fact, one the first technologies developed, and the earliest examples of these technologies are still the most economically important. Early use primarily consisted of methods of fermentation, both for preserving foods, and for the production of alcoholic beverages. In - [APOPTOSIS](https://www.scq.ubc.ca/apoptosis/) - (August 2004) Introduction Apoptosis, or programmed cell death, is a highly regulated process that allows a cell to self-degrade in order for the body to eliminate unwanted or dysfunctional cells. During apoptosis, the genome of the cell will fracture, the cell will shrink and part of the cell will disintegrate into smaller apoptotic bodies. Unlike - [CELL SURFACE RECEPTORS: A BIOLOGICAL CONDUIT FOR INFORMATION TRANSFER](https://www.scq.ubc.ca/cell-surface-receptors-a-biological-conduit-for-information-transfer/) - The behavior of a cell often relies on the chemical signals it is exposed to in its environment. In general, two types of chemical signals can be found floating through the cellular environment: water-soluble (hydrophilic) molecules or fat-soluble (hydrophobic) molecules. Both are important components of cellular communication and physically interact with cellular structures to facilitate - [CONVERSING AT THE CELLULAR LEVEL: AN INTRODUCTION TO SIGNAL TRANSDUCTION](https://www.scq.ubc.ca/conversing-at-the-cellular-level-an-introduction-to-signal-transduction/) - (August 2003) Conversation in the biological world is quite natural. Even on the level of the cell, a busy broadcast of communications is occurring; a fact which has caught the attention of biologists. Today, one of the hottest areas in cell biology research is the study of 'signal transduction'. Signal transduction is the study of - [ONCOGENES: THE (AUTOSOMAL) DOMINANT EVIL](https://www.scq.ubc.ca/oncogenes-the-autosomal-dominant-evil/) - (August 2003) In the beginning, there were chickens Surprisingly enough, our understanding of tumour formation has its roots not in humans, but in the chicken. For the past century it has been known that viruses can be causative agents of cancer. Cancer-causing elements were first described in viruses infecting poultry in 1909 [1]. Later, it - [PROTEIN PHOSPHORYLATION: A GLOBAL REGULATOR OF CELLULAR ACTIVITY](https://www.scq.ubc.ca/protein-phosphorylation-a-global-regulator-of-cellular-activity/) - (August 2003) As early as the 19th century it was known that phosphates could be bound to proteins. Most examples of these 'phosphoproteins' were found in milk (caseins) and egg yolk (phosvitin) and were simply considered a biological method of providing phosphorus as a nutrient. Therefore, the existence of phosphoproteins was considered a consequence of - [G PROTEINS: MOLECULAR SWITCHES FOR SENSING THE ENVIRONMENT](https://www.scq.ubc.ca/g-proteins-molecular-switches-for-sensing-the-environment/) - (August 2003) Cells show an astounding awareness of the environments in which they find themselves, actually adapting their behavior to changing surroundings. The key to this ability is a constant sampling of the multitude of molecules found in their environments, many of which are signals that convey information to the cell [1]. To do communicate - [NATIONAL CENTER FOR BIOTECHNOLOGY INFORMATION: AN OVERVIEW](https://www.scq.ubc.ca/national-center-for-biotechnology-information-an-overview/) - (September 2004) It is well acknowledged that scientific information is being generated at an exponentially increasing rate. One recent molecular biology endeavor is of particular public interest: The Human Genome Project (HGP) sequenced and mapped the complete human genome. Though the HGP was completed successfully, the work of the HGP is far from over. The - [DeCODEING ICELAND'S DNA](https://www.scq.ubc.ca/decodeing-icelands-dna/) - (August 2003) Where's the best place to hunt for genes that underlie cancer and heart disease? CEO Kari Stefansson and his colleagues at deCODE Genetics believe the relative homogeneity of Iceland's population should make it a good place to investigate the genetics factors involved in human disease. DeCODE hopes to profit by selling their knowledge - [WHAT IS BIOINFORMATICS?](https://www.scq.ubc.ca/what-is-bioinformatics/) - Bioinformatics involves the integration of computers, software tools, and databases in an effort to address biological questions. Bioinformatics approaches are often used for major initiatives that generate large data sets. Two important large-scale activities that use bioinformatics are genomics and proteomics. Genomics refers to the analysis of genomes. A genome can be thought of as - [THE HUMAN GENOME PROJECT: THE IMPACT OF GENOME SEQUENCING TECHNOLOGY ON HUMAN HEALTH](https://www.scq.ubc.ca/the-human-genome-project-the-impact-of-genome-sequencing-technology-on-human-health/) - (August 2003) What is the Human Genome Project? Genome sequencing technology has led to many recent scientific breakthroughs. These breakthroughs have captured the interest of the public and are being reported with excitement by both the media and scientific journals. The completion of the human genome project (HGP) is an example of newsworthy science that - [GENOME PROJECTS: UNCOVERING THE BLUEPRINTS OF BIOLOGY](https://www.scq.ubc.ca/genome-projects-uncovering-the-blueprints-of-biology/) - (August 2003) In the early days of genetics, scientists did not have the resources to look at more than a few genes at a time. This made the process of understanding the influence of genetics on an organism slow and arduous. Scientists were faced with the enormous task of attempting to understand genetic influence with - [DEM BONES, DEM IMPORTANT BONES](https://www.scq.ubc.ca/dem-bones-dem-important-bones/) - (August 2005) Have you ever wondered what life would be like with no skeleton? Or how your body goes about maintaining such a complex structure? Without it you would be no more than a mound of wobbly flesh and skin, and yet you have likely never given it a moment's thought. However, the science of - [THE ROLE OF INTEGRINS IN WOUND HEALING](https://www.scq.ubc.ca/the-role-of-integrins-in-wound-healing/) - (August 2005) Wound repair is a critical part of the maintenance of skin and mucosa. It involves a complex series of interactions and cooperation between the superficial skin cells (epidermal cells), cells from the lower layer of skin (dermal cells), and cells of our body's defense system (immune cells) [1]. After the skin has been - [CATIONIC PEPTIDES: A NEW HOPE](https://www.scq.ubc.ca/cationic-peptides-a-new-hope/) - (August 2004) The discovery of penicillin in 1929 by Alexander Fleming was a milestone in modern medicine [1]. In 1943, the industrial-scale production of penicillin enabled its widespread use and ushered in the beginning of the "antibiotic era." The availability of antibiotics has had profound effects on human health and has contributed to an eight-year - [ATTACK OF THE SUPERBUGS: ANTIBIOTIC RESISTANCE](https://www.scq.ubc.ca/attack-of-the-superbugs-antibiotic-resistance/) - In the past 50 years, antibiotics have been critical in the fight against many diseases and infections. Their discovery was one of the leading causes for the dramatic rise of average life expectancy in the 20th century and their significance to public health would be impossible to overstate. Antibiotics are defined as any compound which - [FUNDING IN THE HEALTH SCIENCES](https://www.scq.ubc.ca/funding-in-the-health-sciences/) - (August 2005) These days, no idea or innovation can get off the ground without money, and scientific research is no exception. But unlike many commercial pursuits, research often does not produce lucrative rewards in the short term. Many research projects do not make marketable discoveries for years, sometimes even decades. And to make things even - [PROSTATE CANCER](https://www.scq.ubc.ca/prostate-cancer/) - (August 2004) Introduction to Prostate Cancer The prostate is a small gland about the size and shape of a walnut situated just below the bladder and surrounding the urethra (the vessel that carries urine)(See Fig. 1). The prostate produces the seminal fluid in which sperm is transported. Figure 1. The Prostate Gland A cancer arises - [FROM DYES TO PEPTIDES: THE EVOLUTION OF ANTIBIOTIC DRUGS](https://www.scq.ubc.ca/from-dyes-to-peptides-the-evolution-of-antibiotic-drugs/) - (August 2004) In the last century, nothing has made a bigger impact on human health than antimicrobial chemotherapy [1]. After 20 years of clinical use, antibiotics have increased the average human life expectancy by ten years while in comparison, curing cancer would only only extend life expectancy by two years [1]. From 1900 to 1990, - [LEPTIN: A PIECE OF THE OBESITY PIE](https://www.scq.ubc.ca/leptin-a-piece-of-the-obesity-pie/) - (August 2004) Approximately 23% of Canadians [1] and 200 million [2] people worldwide are considered obese, an increase from 10 years ago. Obesity is usually associated with but not limited to developed nations. In addition to social stigmas, there are significant health risks that come with being overweight. Studies have shown that having excess weight - [HUMAN CLONING: SCIENCE FICTION OR REALITY?](https://www.scq.ubc.ca/human-cloning-science-fiction-or-reality/) - (August 2004) On 27th December, 2002, Dr. Brigitte Boissilier, scientific director of Clonaid, claimed the birth of the first cloned human. The announcement was greeted with revulsion from the general public and skepticism among the scientific community. Although the world still awaits scientific verification of this procedure, the claim intensified the ongoing public debate regarding - [SMALLPOX: THEN AND NOW](https://www.scq.ubc.ca/smallpox-then-and-now/) - (August 2004) Of all human infectious diseases, smallpox is believed to have resulted in more human deaths throughout history than from any other single pathogen. The causative agent of smallpox, Variola virus, was eradicated from natural existence in 1977, through a global vaccination effort administered by the World Health Organization (WHO). Currently, the only official - [HUNTINGTON DISEASE: OVERVIEW OF A GENETIC NEURODEGENERATIVE DISORDER](https://www.scq.ubc.ca/huntington-disease-overview-of-a-genetic-neurodegenerative-disorder/) - (August 2004) Huntington disease (HD) is a rare, progressive and fatal autosomal dominant neurodegenerative disorder, typically of adult onset. In 1872, Dr. George Huntington (1850-1916), a family doctor in the U.S., published the first paper on the disease that he called "Huntington's chorea" [1]. A chorea is an abnormal, involuntary movement. The name comes from - [PRIONS: INFECTIOUS PROTEINS REPSONSIBLE FOR MAD COW DISEASE](https://www.scq.ubc.ca/prions-infectious-proteins-repsonsible-for-mad-cow-disease/) - (August 2003) Prions and prion diseases have been widely discussed in the media in recent years. The interest in prions and prion diseases was stimulated by the outbreak of bovine spongiform encephalopathy (BSE or Mad Cow Disease) in Europe in the mid-nineteen-nineties. This is a relatively new area of study. What exactly has been discovered - [VIRAL INFECTION](https://www.scq.ubc.ca/viral-infection/) - (August 2004) Viruses were first described as agents that were not retained by the unglazed porcelain filters that early researchers used to remove bacteria from solution. In 1898, scientists observed that the agents responsible for foot and mouth disease, as well as tobacco mosaic disease, were filterable. It was discovered that these agents would not - [THE NEW MACDONALD PHARM](https://www.scq.ubc.ca/the-new-macdonald-pharm/) - (August 2003) Imagine a typical drive through the countryside. As you look out your window, you notice a farm. There are cows and sheep grazing on grass, chickens in the coop and pigs in the sty. However, this is no ordinary farm. What you don't see is a blood clotting factor being produced in the ## Pages - [HOME](https://www.scq.ubc.ca/) - The Science Creative Quarterly (SCQ) is not a quarterly, but instead publishes new material at a non-linear rate. Currently, it is sleeping and in a sort of stasis (turpor?) It used to seek science writing of any genre, and your contribution would have involved checking out our submissions guidelines. The Science Creative Quarterly (SCQ) has - [submit](https://www.scq.ubc.ca/submissions/) - basic | detailed | tips - BASIC SUBMISSION GUIDELINES - Anything will do, but if you like more direction, we are happy to look at: (Above all) things that are funny. (But also) anything else really. Things with some link (however weak) to science. Things in English. Things in other languages that are more or - [about (the SCQ)](https://www.scq.ubc.ca/about/) - - A WORTHY CAUSE INDEED - Dear Reader, Several years ago, during most mornings, somewhere in the landscape of children’s television, you would hear Taj Mahal singing and Joan Cusack narrating – not about sharing, or taking turns, or telling the truth, or even potty training for that matter, but actually on (of all things) - [image (bank)](https://www.scq.ubc.ca/image-bank/) - This is an image file databank for most of our textbook related resources. Look for the image file name in the textbook piece below to see if a high res version exists. These graphic files are protected under the creative commons licence (click icon above). Please attribute the image to "The Science Creative Quarterly", the ## Categories - [humour](https://www.scq.ubc.ca/category/humour/) - [textbook](https://www.scq.ubc.ca/category/textbook/) - [creative](https://www.scq.ubc.ca/category/creative/) - [news](https://www.scq.ubc.ca/category/news/) - [archive](https://www.scq.ubc.ca/category/archive/) - [commentary](https://www.scq.ubc.ca/category/commentary/) - [journal club](https://www.scq.ubc.ca/category/journal-club/) - [classroom](https://www.scq.ubc.ca/category/classroom/) - [rant (WTF?)](https://www.scq.ubc.ca/category/rants-wtf/) - [review](https://www.scq.ubc.ca/category/review/) - [weeklong](https://www.scq.ubc.ca/category/weeklong/) - [math](https://www.scq.ubc.ca/category/math/) - [bastard technology](https://www.scq.ubc.ca/category/bastard-technology/) - [impressions](https://www.scq.ubc.ca/category/impressions/) - [pin-up](https://www.scq.ubc.ca/category/pin-up/) - [web experiment](https://www.scq.ubc.ca/category/web-experiment/) - [Science Links](https://www.scq.ubc.ca/category/science-links/) - [metrics](https://www.scq.ubc.ca/category/metrics/) - [contest](https://www.scq.ubc.ca/category/contest/) - [symposia works](https://www.scq.ubc.ca/category/symposia-works/) - [visuals](https://www.scq.ubc.ca/category/visuals/) - [activity](https://www.scq.ubc.ca/category/activity/) - [special](https://www.scq.ubc.ca/category/special/) - [terry project](https://www.scq.ubc.ca/category/terry-project/) ## Tags - [wookiee](https://www.scq.ubc.ca/tag/wookiee/) - [genomics](https://www.scq.ubc.ca/tag/genomics/) - [Harry Potter](https://www.scq.ubc.ca/tag/harry-potter/) - [star wars](https://www.scq.ubc.ca/tag/star-wars/)