journal club

HOW TO MAKE A HAIRLESS WOOKIEE: IDENTIFICATION AND FUNCTION OF DE NOVO GLABR GENE IN WOOKIEE WOOKIEE

By | archive, journal club

(This is the THIRD paper on a special issue on Wookiee science. You can read the first here, and the second here).

APCMV01p29pageone

Annals of Praetachoral Mechanics. (2014). Vol 1. pp29-38 pdf download.

ABSTRACT

We present evidence for the de novo origin of the Wookiee wookiee protein-coding gene GLABR since their divergence from humans. This gene has no protein-coding homolog in any other genome but its presence is supported by evidence from expression and hybridization data. Furthermore, other near-human species such as Zeltron, Chiss, and Sullustan share the human ortholog of this locus, which supports the inference that the ancestral sequence was noncoding, and that the GLABR has de novo origins in the Wookiee. This GLABR gene was further characterized by a conditional knockout experiment as well as an in situ hybridization on sectioned epithelial cells in order to better determine its function. Our results show that the GLABR gene is responsible for robust hair growth in Wookiees, and that inactivation of this gene results in reduced androgenic hair growth or hairless phenotype.

Keywords: GLABR, hair gene, hair loss, Wookiee wookiee

INTRODUCTION

New Order Laboratories is a subsidiary of the former X1’s Fortress. Originally established as a cloning laboratory, it has since expanded to include an active research and development program. At New Order Laboratories, we aim to expand on the original Wookiee wookiee cloning program, and produce innovative wookiee research to aid the Dark side in their endeavor to rule the galaxy.

Wookiees are favorable to the Dark side due to their destructive bouts of sheer rage, and physical strength. As a whole, wookiees possess several other traits conducive to warfare beginning with the fact that they are a tree dwelling species, an attribute denoted by their species name Wookiee, which translates to “People of the Trees.” As tree-dwellers, Wookiees evolved to have skillful hands and claws. Wookiees also possess fangs and a highly advanced sense of smell.

A distinguishing feature of Wookiee wookiee is their “shag carpet” appearance: a trait that in conjunction with their exceptional height makes this native Kashyyyk species immediately recognizable. Notably, visibility is an attribute not conducive to the Dark side’s desired covert operations. W. wookiee as a subspecies are identifiable by their fur, which can be uniform in color or a composite of the colors red, brown, and/or chestnut.

At New Order Laboratories, we aim to identify the biological mechanism responsible for W. wookiee hairiness. In conjunction with the Cloning Division, we hope to eventually create hairless, humanoid Wookiee clones for the Dark side.

To begin, we hypothesize that distinct morphological features, in other words, hairiness are a result of Wookiee specific protein-coding gene(s). As Wookiees are a humanoid species, we postulate that when an all-against-all comparison is done with the Wookiee wookiee and Homo Sapien genomes, a portion of the Wookie genome will be distinct. As a consequence, we suggest that elements of these distinct regions will likely be responsible for the hairiness or uniform coat of hair that is so distinct.

MATERIALS AND METHODS

Systematic analysis of the Wookiee genome
A complete BLASTP search of all human, and Wookiee proteins from Ensembl (Hubbard et al. 2007) v 46 with an E-value threshold of 1 x 10-4 was performed according to the protocol set forth in Knowles and McLysaght (2009). Un-ambiguous orthologs were identified and synteny blocks anchored to these regions. A region of 10 genes or less was deemed an acceptable gap between anchors, and thus variability in the gene order was allowed. Anticipated orthologous ORFs in the regions above were defined as BLAT (Kent 2002) or SSearch (Pearson and Lipman 1988) sequence matches.

Ensembl noted several orthologs in more distantly related humanoid species. Further examination of the annotated orthologs was completed to determine if these were old genes that became inactivated in wookiees. Potential orthologs that contained multiple implausible small introns were discarded. For example, the current Ensembl version proposes a Chiss ortholog of BLU31 (gene responsible for their characteristic blue skin), but further investigation concluded that the “gene” lacks possible introns and thus cannot produce any resemblance of a protein in wookiee. Otherwise, the absence of the phenotypic characteristics of plausible orthologs was attributed to the theorized inactivation within the genomes of other humanoid species.

Initial de novo gene candidates were as follows: 100 had a sequence in the expected human region; 65 had conceivable orthologs in the expected human region; 20 candidates exhibited partial nucleotide similarity; 9 Wookiee genes were deemed artifacts; and one candidate had a possible ortholog in Ewok. A final list of candidates consisted of 5 genes: 4 had uninterrupted ORF in Wookiee of at least 50% of the length of the human ORF.

Multi- PipMaker (Schwartz et al. 2000) was used to align the sequence of the wookiee gene to the syntenic location in the human genome. JalView (Clamp et al. 2004) was employed to visualize the sequences and make manual adjustments when applicable.

Wookiee subjects
Wookiee wookiee (New Order standard) samples were obtained from the Wookiee wookiee clonal collection on planet Mustafar. Specimens used in quantitative RT-PCR experiments were kept under controlled conditions for 3-5 days.

Knockout wookiees
Conditional knockout wookiees were generated via gene targeting in wild-type standard W. wookiee by TaconicArtemis. In situ hybridizations were done on [carbonite]-sectioned material with a dioxygenic-based labelling system. Northern blots were done with 10µg total RNA via denaturing agarose gel electrophoresis.

Microarray analysis
Microarray analysis was done on the Wookiee Genome 430 2.0 array, and probe data from the Imperial standard CEL files were normalized via the MAS5 method with the R-based bioconductor software. The normalized probe set data was searched for differentially expressed genes with the significance analysis of microarrays.

RESULTS AND DISCUSSION

Identification of W. wookiee genes with no protein-coding match in protein database or syntenic human genomic region
Principal sites of synteny were established between the human and W. wookiee genome using unambiguous orthologs or shared regions pinpointed by the BLASTP search hits. Synteny blocks established spanned 82% and 74% of the human and Wookiee genomes, respectively, and 18,505 of the 22,568 human protein-coding genes characterized in Ensembl were identified within the established range.

A region of 10 genes was established as an acceptable gap between blocks due to the expected high gene order conservation between the two species. An additional screen for plausible orthologs was conducted in these regions as probability higher for the noted locations in the genome.

An initial 200 candidate Wookiee proteins were identified (no BLASTP hit in the human genome). For 65 proteins, a plausible ortholog existed but upon further examination with BLAT and SSearch only partial nucleotide similarity was identified, leaving 20 candidates. Wookiee genes with conceivable orthologs in other species were also excluded i.e. ewok ortholog.

For the purposes of this screen, only characterized or known W. wookiee genes by Ensembl were considered. Above protocol resulted in one Wookiee protein-coding gene (GLABR) that did not appear to have an ortholog in any other species; genome, however there did appear to be sequence similarity at the expected location of the gene in humans. It is therefore possible that the GLABR gene is of de novo origin. (GLABR was assigned to the Wookiee protein coding for hairlessness as “glaber,” a Latin word meaning hairless or bald).

In order to confirm the de novo origin of the GLABR ortholog, we performed a multiple sequence alignment of the GLABR sequence with the orthologous human sequence (Figure 1). The critical mutation that allows the production of a protein is the deletion of an A nucleotide in the GLABR ortholog, which is present in the human ortholog. This causes a frameshift in Wookiee that results in a much longer ORF capable of producing a 137-amino-acids-long protein; in contrast, the human sequence has a stop codon after only 78 potential codons.

fig01APCMv01p29

Figure 1. (Click to Enlarge) Sequence changes in the origin of W. wookiee GLABR from noncoding DNA: multiple sequence alignment of the gene sequence of the W. wookiee gene GLABR and similar nucleotide sequences from the syntenic location in humans. The start codon is indicated on the figure.

The identified W. wookiee transcript GLABR spans a 453kb region that can be aligned with the human genome, but the human homeolog is free of annotated transcripts or expressed sequence tags (ESTs). We prepared a northern blot with RNA from wookiees and from humans to substantiate the findings that the human aligned region is not expressed (Figure 2); a signal was obtained from the standard W. wookiee subspecies as well as the wild-type W. wookiee species, but not from the human, and other closely related near-human species. This indicates that the non-coding ortholog of the gene is the ancestral sequence, and the gene that confers hairiness to W. wookiees must have originated after the speciation event, approximately 4.7 million years ago. Thus, the gene must have arisen de novo in W. wookiee.

Fig02APCMv01p29

Figure 2. (Click to Enlarge) Northern blot with RNA from Wookiees, human, and related humanoid species. 1kb mRNA fragment containing the putative GLABR sequence is observed only in Wookiee samples, denoting non-expression in other humanoid type gene expression profiles. Note in this figure, the old New Order nomenclature for W. wookiee (W. rwook) is used.

GLABR protein function
We designed a conditional knockout of the whole gene region to study the function of this GLABR and confirm our hypothesis. We find that the wookiees that lack the GLABR transcript “W. wookiee glaber” are viable and fertile, and the general physiology is not changed, aside from the reduction in androgenic hair growth (Figure 3).

fig03APCMv01p29

Figure 3: (Click to Enlarge) Artist’s representation of a wild-type wookiee (left) and the GABR variant (right). The latter exhibits a marked reduction in androgenic hair, but the vellous hair is still present.

Skin samples were taken from wild-type and GLABR strain wookiees and in situ hybridizations were performed on carbonite-sectioned epithelial material with a dioxygenic-based labeling system (Figure 4). The wild-type section exhibits higher androgen localization towards the androgenic hair roots, whereas the GLABR variant section exhibits much less. These results complement the previous observation that androgenic hair growth was markedly reduced in the GLABR variant (Figure 3). Although for the purpose of this study, it was only necessary to confirm that there was reduced hair growth in the GLABR variants, it would be worth investigating the exact mechanism by which this reduction occurs. Such studies would also examine possible side effects exhibited in the knockout variant.

fig04APCMv01p29

Figure 4: In situ hybridizations on carbonite-sectioned epithelial specimens from wild-type and GLABR variants, with a dioxygenic-based labeling system.

CONCLUSIONS

This is the first study to focus on uncovering the gene or mechanism behind Wookiee wookiee’s characteristic coat of hair. It is also serves as the first comparative human to W. wookiee genome research. Prior to this research, there are few reports of research into wookiees, and none assessing what genome similarity with humans (if any) could be responsible for their humanoid appearance.

The GLABR protein described in this study functions exclusively to code for W. wookiee’s hairiness. As noted in our results, the hairless wookiee phenotype does not appear to exhibit additional morphological or physiological changes, although we did observe some anecdotal evidence of behavioural modifications. In our knockout W. wookiee glaber (or “Chewie2.0” as we called him), we noted a more docile demeanor when conducting routine laboratory assessments. We hypothesize that the resulting hair loss correlates to a hormonal difference in the normal wookiee androgen levels. This possibility is concerning as it may preclude undesirable physical changes, such as (but not limited to) reductions in muscle mass or physical strength. At present, a research program is being developed to resolve whether this phenomenon is present in all subsequent knockouts.

Further study is also warranted to assess W. wookiee glaber skin sensitivity. While not usually an apparent issue in the species, it is conceivable that rendering them hairless may manifest problematic symptoms. Here, we noted several rash-like symptoms when subjects were clothed, although it remains unclear whether this was a reaction to the garment’s material, or due to other environmental factors such as room temperature or light. W. wookiee culture does not generally encourage individuals to be clothed, but one could argue that such items are deemed culturally unnecessary due to their thick coat of hair. Nevertheless, as seen in mammals, it is likely that W. wookiee hair provides protection from the environment. It is therefore important to weigh the positive and negative impacts of generating a hairless knockout in the context of these various points.

The gene reported in this study is the first case of a W. wookiee protein-coding gene that appears to be restricted to the W. wookiee genome. It is well-documented by this research that the GLABR protein-coding gene is not present in the human genome or any other humanoid species. It is therefore likely that the gene appeared in the W. wookiee genome after the divergence from the human lineage. To conclude, we would hypothesize that Wookiee-specific genes are responsible for Wookiee specific traits i.e. GLABR is responsible for hairiness in Wookiees. It will be interesting going forward to explore whether non-specific genes in Wookiees code for similar characteristics between humanoid species.

Acknowledgments
The authors would like to thank the dark side of the Force, and Conan Motti for donating his life to Science (source of Homo sapien tissue).

Conflict of interest
Dark side.

Funding
The authors gratefully acknowledge the funding support from the New Order and the Dark Lords of the Sith for a studentship awarded to E.M. J.S. was supported through a NOR research scholarship from the Galactic Research Council.

LITERATURE CITED

Clamp M, Cuff J, Searle SM, Barton GJ. (2004) The Jalview Java alignment editor. Bioinformatics 20:426–427.

Heinen, TJ, Staubach F, Haming D, Tautz D (2009) Emergence of a new gene from an intergenic region. Current Biology 19:1527-31.

Hubbard TJ, Aken BL, Beal K, Ballester B, Caccamo M, Chen Y, Clarke L, Coates G, Cunningham F, Cutts T, et al. (2007) Ensembl 2007. Nucleic Acids Res 35:D610–D617.

Kent WJ. (2002) BLAT—the BLAST-like alignment tool. Genome Res 12:656–664.

Knowles, DG, McLysaght A. (2009) Recent de novo origin of human protein-coding genes.
Genome Res 19:1752-9.

Pearson WR, Lipman DJ. (1988) Improved tools for biological sequence comparison. Proc Natl Acad Sci 85:2444–2448.

Schwartz S, Zhang Z, Frazer KA, Smit A, Riemer C, Bouck J, Gibbs R, Hardison R, Miller W. (2000) PipMaker—a web server for aligning two genomic DNA sequences. Genome Res 10:577–586.

About Emily Murphy and Jenny Shin

Jenny Shin studies Biology at the University of British Columbia. She is delighted that this paper has been a source of enlightenment for the Dark Side. Emily Murphy is a 1st-year MSc student in the Department of Wood Science. When not weeping over her willow in the lab, she enjoys listening to peppy East Coast jigs and long drives through the countryside.

GENETIC BASIS FOR FORCE-SENSITIVITY IN WOOKIEES

By | journal club

(This is the second paper on a special issue on Wookiee science. You can read the first here).

JPCMV1pp21front

Annals of Praetachoral Mechanics. (2014). Vol 1. pp21-28 pdf download.

ABSTRACT
Midi-chlorians are sentient life forms, which live in endosymbiosis with all living cells (1). The number of midi-chlorians per cell has been found to correlate with influence in the force (2) and, as such, blood analysis has become common practice for the identification of force-sensitives, particularly by the Jedi Order. However, the genetic basis for increased midi-chlorian replication in force-sensitives is unknown. Here we show drivers to be mutations at both positions 263 and 312012 in Wookiee wookiee midi-chlorian DNA (mdDNA). We anticipate our findings to be a starting point for in vivo studies linking these mutations to force-sensitive phenotypes.

Key words: Force-sensitivity, midi-chlorian, single nucleotide variants

INTRODUCTION

The need for a powerful army has grown more pertinent in the wake of the rebellion against the Empire. Much research has been aimed at creating powerful fighters for the Sith (3). Sand People, Twi’lek, and Mon Calamari have all been considered, but Wookiees (Wookiee wookiee) are of particular interest due to their intelligence, large size, incredible strength, and unwavering loyalty (4). While powerful in their own right, Wookiees armed with the ability to harness the force have the potential be unstoppable soldiers. As the ability to harness the force has been correlated with midi-chlorian count in red blood cells (5), methods for increasing midi-chlorian count in Wookiee cells are of profound interest. However, and for as yet unknown reasons, all experiments that have aimed to increase expression of Wookiee specific midi-chlorians within Wookiee species have proved unsuccessful. More recently, evidence has demonstrated that force sensitive humans not only have higher numbers of midi-chlorians, but that several specific single nucleotide polymorphisms within the midi-chlorian genome may be responsible for hyper proliferation. Consequently, there have already been attempts to directly transplant force-sensitive-human midi-chlorians into Wookiee oocytes. However, these attempts have also failed, indicating Wookiee mdDNA and human mdDNA differ by genes essential for Wookiee cell proliferation (6). As a result, more advanced genetic techniques, and elucidation of midi-chlorian genome structure, are required to increase midi-chlorian count in Wookiees.

Here, we report sequence for both Human and Wookiee midi-chlorian genomes, and identify candidate mutations linked to Dark-side force-sensitivity. We then show characterization of synthesized artificial Wookiee mdDNA containing these candidate mutations. In particular, we determine effects on host-midi-chlorian replication by qPCR.

METHODS

Collection and Preparation of Blood Samples
mdDNA was isolated from blood samples as previously described (14). Briefly, blood cells were lysed by incubation with SDS and Protenase K, and then whole-cell lysates were subject to CsCl–bisbenzimide gradient centrifugation. CsCl–bisbenzimide gradients allow for separation of nuclear DNA from mdDNA based on A + T content (mdDNA is A+T rich). DNA quality was assessed by spectrophotometry (260 nm/280 nm and 260 nm/230 nm absorption ratios) and gel electrophoresis prior to library construction.

Midi-chlorian DNA Extraction
1ng input mdDNA was prepared using Nextera XT DNA Sample Preparation Kit (Illumina). Samples were barcoded with a 13bp unique index on each end to allow for analysis of 96 samples per flowcell, while maintaining coverage of >10000x per midi-chlorian genome. Libraries were sequenced with 2×150 bp reads on the Illumina JediSeq 2000 system.

Midi-chlorian Protein Extraction
Enriched midi-chlorians were lysed by adding 1ml Qiagen Native Lysis Buffer, and incubating on ice for 30 minutes with periodic gentle agitation.

Synthesis and Isolation of Midi-chlorian Genome
The Gibson et al. assembly method (9) was used to generate a synthetic midi-chlorian genome. It was important to minimize genome manipulation during the detergent and proteolytic enzyme treatments by suspending the cells in agarose blocks. Intact chromosomes were immobilized in the resulting cavern in the agarose that originally held the cell. Digested protein components, lipids, RNAs, and sheared genomic DNAs could then be removed by dialysis or electrophoresis from the immobilized intact genomic DNA. Whole, intact genomic DNA isolation was performed using a CHEF Mammalian Genomic DNA Plug Kit from Bio-Rad (7).

Isolation of midi-chlorians
Human and Wookiee blood samples were centrifuged at 600xg for 15 minutes to pellet cells. Cell pellets were resuspended in PBS to a final concentration of 1×108 cells/ml. Cell suspensions were lysed by forced movement through a 27G syringe needle, in the presence of a protease inhibitor cocktail (Roche, Germany). Crude cell lysate was incubated with 30ul anti-MATR microbeads for 60 minutes at 4°C. Treated lysate was loaded onto preequilibrated MACs column (Milyenyi Biotec). The column was placed in a MACS Separator (Miltenyi Biotec) and then midi-chlorians were washed and eluted according to Hornid-Do et al.’s method (8). Midi-chlorians were then pelleted and resuspended in MdIB (Midichlorian Incubation Buffer, Sigma-Aldrich).

Removal of original midi-chlorian genome
The native midi-chlorian genome was extracted under an inverted microscope (Nikon; model TMD). Cored Glass Tubes (Narishige; GD-1: I. D., 0.75 mm x O. D. 1 mm x length, 90 mm) and a Pressure Microinjector (Narishige; model IM-5B) were used with the added control of a Joystick Hydraulic Micromanipulator ((Narishige; system MO-204) to apply gentle suction and remove the native genome.

Insertion of synthesized midi-chlorian genome
CHEW5 cell line obtained from Dr. Darklord at Imperial University. CHEW5 in a 6-ml culture of SOB medium containing 17% fetal bovine serum and 0.5% glucose. Incubation was at 37°C until the medium pH was 6.2. Cells (5 to 50 × 107 cells/ml) were then spun in a centrifuge at 4575g for 15 min at 10°C. Cells were washed once [Tris 10 mM and NaCl 250 mM (pH 6.5)], resuspended with 200 ml of CaCl2 (0.1 M), and held on ice for 30 min. Synthetic midi-chlorian genome agarose plug was then added.

Real-time PCR
Primers and probes were designed using Primer 3, and checked for possible hairpin and self-dimer formation using IDT Oligo Analyzer 3.1. swBLAST was used to ensure specificity to the target of interest. Assays were validated, both in singleplex and multiplex, using dilution series of purified Wookiee mdDNA and purified Wookiee nuclear DNA (supplemental).

GAPDH Forward Primer: TCTCTGCTTCTGATGGCTCAAAC
GAPDH Reverse Primer: TGCTCTTCCGATCTGACAGCGACC
GAPDH Probe: 5’-FAM-TATTCGAGTAGC-MGBNFQ-3’
WOMDC Forward Primer: GGCTACCTATGAGGTCACTTTA
WOMDC Reverse Primer: TTCAGGTAGTAACACTGGGTA
WOMDC Probe: 5’-VIC-GGCTATCAACGT-MGBNFQ-3’

Real-time PCR was performed using the TaqMan® Fast Universal PCR Master Mix from Applied Biosystems (10ul of TaqMan® Fast Universal PCR Master Mix (2✕), No AmpErase® UNG, 0.5ul of 10uM GAPDH Probe, 0.8ul of 10uM GAPDH Forward Primer, 0.8ul of 10uM GAPDH Reverse Primer, 0.5ul of10uM WOMDC Probe, 0.8ul of 10uM WOMDC Forward Primer, 0.8ul of 10uM WOMDC Reverse Primer, 4.8ul of H2O, and 1ul of lysed culture). Thermocycling was carried out on a BioRad DNA Engine with Chromo4 Real-time PCR Detector (hot-start at 95 °C for 20 s, and 50 cycles of 1 s at 95 °C and 20 s at 60 °C).

RESULTS AND DISCUSSION

Single Nucleotide Variant Determination
Whole blood samples were obtained from 96 non-force-sensitive (NFS) Humans, 10 Sith, and 86 Wookiees. Specimens were collected as part of a research project approved by the Empire Force Agency Research Ethics Board (EFA REB). We sequenced the mdDNA isolated from each sample. NFS Human, and Wookiee midi-chlorian genomes were de-novo assembled using ABySS (12) with N50 sizes ranging from 34624 to 50348. Single nucleotide polymorphisms (SNPs) within the NFS Human subset were identified using SAMtools (supplementary Figure 1).

Sith mdDNA reads were aligned to the NFS Human draft genome using Burrows-Wheeler Aligner version 0.5.4 (13). Screening for SNPs by SAMtools followed by subtraction of known SNPs from the NSF human data set yielded four single nucleotide variants (SNVs) at positions: 257 (A/G), 35768 (T/G), 274491 (G/T), and 289002 (T/G).

We then used Projector, a pair hidden Markov model-based program, to identify homologues to the Sith midi-chlorian genes containing SNVs in the Wookiee midi-chlorian genome (11). Candidate SNVs positions in the Wookiee midi-chlorian genome were then identified by visual inspection of gene homologs: 263 (A/G), 35769 (G/T), 266724 (A/G), and 312012 (C/T).

Midi-chlorian Synthetic Genome Synthesis
Using Gibson et al.’s technique for chemical genomic synthesis (7), we created 15 synthetic Wookiee midi-chlorian genomes containing mutations at the positions of the candidate SNVs identified (Table 1). Synthetic genomes were prepared for storage and transformation using CHEF Mammalian Genomic DNA Plug Kit from Bio-Rad, as in Gibson et al. (2009) (7).

APCMV1p21table01

CHEW5 Mutant Creation
Midi-chlorians were extracted from human and Wookiee blood, using Hornig-Do et al.’s magnetic field method, along with MACs Column and Separator from Miltenyi Biotec (8). Whole midichlorian extract was 99% pure, as determined through blotting of crude cell lysate and enriched midi-chlorians using probes for β-actin (cytoskeleton), GAPDH (cytosol), Rab4 (Golgi apparatus), Golgin-97 (endosome), and HanSo (midi-chlorian).

The native Midi-chlorian genome was removed under an inverted microscope using a microsyringe, leaving the wookie midi-chlorian intact. Midi-chlorian synthetic genomes were transferred into genome-free Wookie Midi-chlorians using the Lartigue et al. method (7), involving treatment of midi-chlorians with CaCl2 and then heat shock in the presence of synthetic genome agarose plugs. To ensure only midi-chlorians containing a single genome were carried through to subsequent steps, suspensions were incubated with a FISH probe specific to a repetitive region of the Wookiee midi-chlorian genome (6) and then FACS was used to sort midi-chlorians: negligible fluorescence intensity indicating that the midi-chlorian did not successfully take up the DNA, one arbitrary fluorescence unit indicating that the midi-chlorian took up one copy of the mdDNA, and two arbitrary fluorescence units indicating that the midichlorian took up two copies of the mdDNA etc. (Supplementary Methods). One midi-chlorian per cell was microinjected into CHEW5 cells, and presence was verified by optical microscopy.

Determination of Midi-chlorian Production by qPCR
Single CHEW5 cells containing midi-chlorians with synthetic genomes (SG), and control CHEW5 cells, were placed into wells of a 96-well plate and were cultured as described previously (6). Five replicates of each were seeded. At 6, 12, 24, 48, 72, and 96 hours after seeding, 2ul of each culture was extracted, lysed (Cell-md Direct Kit, Darth Distributors), and used as template in a two-colour qPCR assay. An assay specific to the constant region of Wookiee mdDNA (WOMDC) was used to assess quantity of midi-chlorians (VIC channel). To account for differences in cell proliferation among cultures, an assay for GAPDH, a housekeeping gene on Wookiee nuclear DNA, was used (FAM channel). The difference in cycle threshold values (ΔCT) between WOMDC and GAPDH assays was used to compare midi-chlorian replication (Figure 1).

APCMV1p21figure01
Figure 1. (Click to Enlarge): Difference in cycle threshold values (ΔCT) between WOMDC and GAPDH assays over 96 hours.

CHEW5-SG13 and CHEW5-SG15 mutants were not viable. Of the remaining 13 CHEW5 mutants, 10 did not significantly differ from normal CHEW5 in their midi-chlorian replication behaviour (p= 0.67, t test). Both CHEW5-SG6 cells and CHEW5-SG8 cells demonstrated high per-cell midichlorian counts, but CHEW5-SG6 mutants appeared unstable, as demonstrated by a consistently decreasing ΔCT over the six time points.

Growth curves for CHEW5-SG8 and CHEW5 cells were obtained by OD600 (Supplementary Figure 4). The presence of the midi-chlorian containing SG8 in the CHEW5 cells does not appear to affect CHEW5 proliferation.

Midi-chlorians were extracted (see Methods) from each CHEW5-SG8 culture, lysed, and the total proteomes were analyzed on a 2 dimensional gel (Figure 2). The boxes highlight a single protein difference between the CHEW5 and CHEW5-SG8 proteomes. As expected this protein corresponds to one found in Sith midi-chlorian.

APCMV1pp21figure02
Figure 2 (Click to Enlarge). Midi-chlorian proteomic analysis. Two-dimensional gels were run using midi-chlorian lysates from (A) Sith cells (B) CHEW5 cells, and (C) CHEW5-SG8 cells. Standard conditions were used for the separation of protein spots in the first dimension on immobilized pH gradient (IPG) strips (pH range 4 to 7) and in the second, SDS-PAGE, dimension (molecular mass 8 to 200 kD) (10). Gels were stained with Coomassie brilliant blue G-250.

CONCLUSIONS

Four SNVs linked to dark-side force sensitivity were determined through sequence alignment of NFS Human and Sith mdDNA. Wookiee genomes containing mutations homologous to the identified human SNVs were synthesized and then inserted into midi-chlorians. Midi-chlorians containing each synthetic genome were inserted into CHEW5 cells. Because of the existing, well-documented link between force-sensitivity and increased midi-chlorian count (2) , qPCR assays were used to identify CHEW5 mutants producing high levels of midi-chlorians. The CHEW5-SG8 mutant, containing mutations at positions 263, and 312012, was found to steadily produce high levels of midi-chlorians. Analysis of the proteome of CHEW5-SG8 midi-chlorians revealed one protein also found in Sith midi-chlorians. To definitively determine that midi-chlorian SG8 imparts force-sensitivity to its host, in vivo experiments are required. Our group has begun preparations for a trial involving transplantation of midi-chlorians containing SG8 into Wookiee oocytes, and in vitro fertilization of these oocytes in to female Wookiees.

LITERATURE CITED

1. Baaka C (2012) in The Wookieepedia Volume 312: Midichondrians as Sentient Life, eds. Ng D, Smith M (Springer, Heidelberg), pp 403–420.

2. Baaka C (2012) in The Wookieepedia Volume 312: Midichondrian Count in Relation to Force Sensitivity, eds. Ng D, Smith M (Springer, Heidelberg), pp 1106–1158.

3. Plageuous D, Nemisis A (2424) The Clone Wars diaries: Attempt to create evil life. Proc Natl Acad Sci EARTH 966:10802-10831.

4. Skywalker L (1999) Physical and social characteristics of Wookiees: a field study. Gal Anal Biol 88:302-333.

5. Calrisian L (2008) in the jedi handbook on midi-chlorian count, ed Kanobe OBO (Springer, Heidelberg) 2:30-40.

6. Sotired I, Falcon M, Iwannagotosleep PLS (2011) Wookiee mdDNA and human mdDNA differ by genes essential for Wookiee cell proliferation, Science 172: 3076-3083.

7. Lartigue C, Glass JI, Alperovich N, Pieper R, Parmar PP, Hutchison III CA, Smith HO, Venter JC (2007) Genome transplantation in bacteria: changing one species to another, Science 317(632); 632-638.

8. Hornig-Do HT, Günther G, Bust M, Lehnartz P, Bosio A, Wiesner RJ (2009) Isolation of functional pure mitochondria by superparamagnetic microbeads, Anal Biochem 389(1): 1-5.

9. Gibson DG, et al. (2010) Creation of a bacterial cell controlled by a chemically synthesized genome. Science 329(52);52-56.

10. Outofideas IAM, (2013) in Intergalactic species midi-chondrial proteome project: humanoids, ed Dorky I, (Silly University Press) pp 300078-487699

11. Meyer IM, Durbin R (2004) Gene structure conservation aids similarity based gene prediction. Nucleic Acid Res. 32(2); 776-783.

12. Simpson JT (2009) ABySS: A parallel assembler for short read sequence data. Genome Res. 19(6): 1117–1123.

13. Li H, Durbin R (2010) Fast and accurate long-read alignment with Burrows-Wheeler Transform. Bioinformatics 26(5):589-95

14. Lang F, and Burger G (2007) Purification of mitochondrial and plastid DNA. Nature Protocols 2(3): 652-660.

About Georgia Russell and Genevieve Rocheleau

Georgia is a Master's student in the Genome Science and Technology program at the University of British Columbia. Her project involves using microfluidic devices to learn more about the immune system's response to cancer. Genevieve is opposed to cuddling and is a 5th year Cell Biology and Genetics student at UBC Vancouver. Although she shys away from various forms of physical comfort, she does make time to work in Dr. Ninan Abraham's lab at the Life Sciences Institute; to volunteer as a Director of Events for UBC REC; and to cook relatively inedible meals.

TRANSCRIPTOME DIVERGENCE BETWEEN COMMON AND CAVE-ADAPTED WOOKIEES

By | archive, journal club

APCMVol1pp7front

- – -

Annals of Praetachoral Mechanics. (2014). Vol 1. pp7-19 pdf download.

ABSTRACT:
Cave-adapted organisms commonly evolve convergent morphological, physiological and behavioral traits. The rare cave-adapted wookie species, Wookiee troglodytus, presents an opportunity to characterize underlying evolutionary mechanisms driving phenotypic expression in a complex sentient humanoid. The cave wookie presents several features associated with adaptation to subterranean habitats: pigment-less hair, reduced visual acuity, overall smaller stature, elongated limbs and decreased aggression. Uncovering the evolutionary processes directing the complex morphological and behavioral traits requires genome-level analysis. To unpack these complex traits, complete nuclear transcriptomes and enrichment profiles were assessed for common wookie populations and the troglomorphic species. Common and troglomorph wookie representative transcriptomes were uniquely divergent in genes and expression levels associated with pigmentation, vision, adrenal gland function, and metabolism.

Key words: Fst, transcriptome, troglomorph, troglobite, sentient

INTRODUCTION

Organisms of widely different evolutionary histories frequently present convergent morphology associated with adaptation to life in caves. “Cave,” as a habitat, is a classification derived from diverse subtypes but shared characteristics of no light, frequently low nutrient levels and high humidity are thought to exert varied and strong selective pressure for subterranean-adaptive features (Romero 2011). Some of these features include: reduced pigmentation, reduced visual-sense apparatus paired to enhanced non-visual sensory systems, decreased or enlarged body size, elongated appendages, reduced aggression and alarm-response (Romero 2011). A recently described species of cave-adapted wookiees present interesting convergent features that correspond with their almost exclusively subterranean life history: pigment-less hair, poor visual acuity, small stature, and extreme passivity. The species is comprised of two known populations that went undetected until 2002 when biospeleotic surveys were prompted after rare sightings of albino wookiees (Dubois and Sinclair 1990, Tong 1993). The survey, conducted by Sphinx et al. (2003), uncovered two extensive cave networks in the northwest Wawaatt archipelago, each resident to populations of pigment-less wookiees. Spikens (2012) classified the two populations as a single new species based on mitochondrial DNA phylogenetic analysis and morphology. In observed specimen, morphological analysis demonstrated: smaller stature (relative to common wookiees), skin and hair absent of pigment, and reduced visual sense (Spickens 2012). Phylogenetic analysis of cytB and 12S mtDNA placed individuals from the two northwest Wawatt cave populations in a single clade sister to a monophyletic clade of individuals from widely distributed populations of W. wookiee. (Spickens 2012). Spickens (2012) described the species, Wookiee troglodytus.

While suites of troglomorphic traits are common, degree of morphological, biochemical and behavioral adaptation varies amongst cave-adapted species because of the independent nature of each adaptive event (Romero 2011). Cave-adapted species display convergent phenotypes but the underlying biological processes may be unique between organisms of different phylogenetic history and in different cave habitats. Additionally, pigment, vision, body arrangement and behavior are complex traits controlled by many simultaneously operating genes and molecular pathways. Genomics based approaches have proven useful in elucidating genetic differences between related taxa presenting complex phenotypic differences as the result of adapting to novel habitats (Gross et al. 2013, Kozak et al 2013).

Gross et al. (2013) identified regions of sequence divergence between transcriptomes of subterranean and surface morphotypes of the Mexican blind cavefish, Astyanax mexicanus. They chose to integrate separately sequenced surface and cave-adapted A. mexicanus transcriptomes into a combined data-set which proved useful for evaluating conserved variation amongst morphotypes. RNAseq data-mining allowed the researchers to identify genes expressed exclusively in either morphotype. Their results showed decreased expression of multiple vision system genes and increased expression of multiple metabolic genes in troglomorph cavefish compared to surface-dwelling cavefish. Genetic mechanisms for physiological adaptation to fresh-water and salt-water habitat between two species of Killifish (Lucaina parva and Lucaina goodyi) and between two interspecifc populations (Lucaina parva) were the subject of Kozak et al. paper (2013). The researchers identified gene regions of high differentiation between fresh and salt-water species and used GO enrichment analyses to uncover the genetic component enabling populations to inhabit different niches. They found differentiated gene-expression in multiple osmoregulation genes between and within species. These experiments demonstrate that comparative transcriptomics can be useful in identifying genetic evolution between phenotypically divergent related taxa.

The diverse evolutionary history of troglomorphs requires a more complete understanding the breadth of genetic evolution among cave organisms. We investigated the underlying genome evolution in W. wookiee and W. troglodytus, as the mechanisms driving phenotypic divergence in cave and terrestrial taxa had yet to be explored in a sentient organism. Given the morphological and behavioral adaptations reported by Spickens (2012), we hypothesized that genes involved in pigment, vision and adrenal system pathways would highly divergent between species. We assembled and analyzed complete transcriptomes from pooled and individually genotyped male and female W. wookiee from four wide-dispersed populations and male and female W. troglodytus from each cave population. Quantifying genome-wide sequence variation between species and populations enabled us to identify genes likely involved in adaptation to caves.

Genome-wide analysis of transcribed genes will further the understanding of divergence between W. wookiee and W. troglodytus and identify what genes are differentially expressed, connecting genotype and expression to phenotype. It will also enable further comparisons between troglomorph transcriptomes of different lineages and complexities, and continue to uncover patterns of genetic evolution in cave habitats.

METHODS

Source Populations
We sampled specimen from each of the two populations of W. troglodytus and four geographically distinct populations of W. wookiee. Each sample population of W. wookiee was a minimum of 1500 km and a maximum of 3000 km from an adjacent sampled population.

Transcriptome
For each population we sampled healthy tissue from five male and five female individuals. Total RNA was extracted using Trizol (in supplementary material) and purified using RNeasy mini kits (Qiagen, Valencia, CA). Male and female samples were pooled by population with an equal proportion of total RNA from each sampled individual (concentrations determined by qPCR).

Pooled samples were sent to Unigens (New York, USA) for library preparation and sequencing on an Illumina HiSeq2000.

Transcriptome Assembly
Illumina sequences were assembled de novo using Velvet (Zerbino and Birney 2008) after being trimmed (removing the first and last 20 bp) using the FastX trimmer. The assemblies were created from all Wookiee spp. sequences using the paired-end option, an insert size of 200 bp, and we tried several of kmer values. The best assembly was under kmer of 20, which generated contigs over 100 bp as follows: 121,636 contigs for troglomorph population 1 (T1) wookiees, 100,030 contigs for troglomorph population 2 (T2) wookiees and 94,142 contigs for the common-wookiees (CW). We found that 92% of the T1 contigs, and 89% of the T2 contigs were represented in the CW assembly. We created our reference based on the CW assembly with a total of 29,881 contigs, combining 2243 contigs from the T1 and T2 assemblies (all unique contigs over 300 bp) with CW contigs that had blast matches to any of the following: (1) related-wookiee proteomes, or (2) target genes of interest (pigmentation, vision and adrenal gland genes). The software suite Galaxy (Giardine et al. 2005) was used to filter results from blastX searches against the uniprot proteomes and retain only contigs that had only 1–3 protein matches per species (blast score ≥ 100). This was done to avoid contigs that were misassembled from multiple genes.

SNP detection and Fst calculations
Each wookiee population was aligned separately to our constructed reference using BWA and its paired-end function from (Li and Durbin 2009). Alignments were then processed with samtools (Li et al. 2009). Single nucleotide polymorphism (SNP) detection and Fst calculation was performed with the software Popoolation2, which calculates population genetic metrics from pooled samples (Kofler et al. 2011). Allele frequencies and Fst between populations were calculated with a minimum coverage of 10 reads per population in order to exclude SNPs from low expressed transcripts. We used a pool size of 5, and a sliding window of 20 bp. The mean number of reads per population for contigs with SNPs was 38.09 in a range of 26.12–51.16. This is an initial step to identify candidate SNPs.

To validate allele frequencies from our pooled analysis, we genotyped individuals from each population at 3485 SNPs using an Illumina Infinium Bead Chip custom designed for Wookiee (containing 1000 candidate SNPs segregating between species, 1300 SNPs segregating between W. wookiee populations and 965 SNPs segregating between W. troglodytus). Bead design was adapted from Kozak et al. (2013) and genotyping protocol can be found in Supporting Information. We genotyped 16 W. wookiee and 12 W. troglodytus using genomic DNA extracted from cheek cells (preserved in ethanol) following the Gentra PureGene protocol (Qiagen).

Inter and Intraspecies Analyses
To look at divergence across troglomorphic adaptations we compared Fst analyses between CW, T1 and T2 wookiees. Fst outlier loci were identified in two sets of contrasts. First, we performed an outlier analysis between interspecific populations to identify loci that evolve quickly between population pair, but are not relevant to subterranean evolution. In CW we compared the Fst in sliding windows between two most geographically distant populations. The same comparison was made between T1 and T2. Second, we compared pooled-common and T1 or T2 pairs. We excluded from consideration as candidate troglomorphic adaptations the outliers that overlapped with those from the geographically distinct cave-dwelling wookiees. In this way, Fst outliers between cave-dwelling and common wookiee pairs should capture adaptive variation across niche-habitats. We then focused on SNPs that were outliers in cave-common pairs in order to detect loci that repeatedly evolve in different light, nutrient and humidity environments.

Table 1. (click to enlarge) Genome-wide Fst estimated between all Wookiee populations across all 38,126 SNP intervals.

APCMtable01

For individual genotypes, we also performed Fst estimation with Infinium bead genotype data. The hierfstat package in R was used to calculate Fst at all possible SNPs with segregating alleles for each of the species/population comparisons (Goudet 2005). The SNP bead probe sequences were aligned with the transcriptome reference using blastn. Genomic SNPs were paired with the corresponding 50 bp window from the pooled analysis and we compared Fst values

from individual genotypes to our pooled data. With the Infinium genotype data, we performed two GO enrichment analyses on outlier loci: (1) between wookiee species and (2) between all cave-dwelling and all common wookiee individuals.

The Fst outliers were identified based on empirical distributions of divergent loci (Beaumont and Balding 2004; Narum and Hess 2011). This approach has been used in several model organisms (Kolaczkowski et al. 2011, Turner et al. 2010, Akey et al. 2010) and in humans (Akey et al. 2002), to identify putative targets of selection.

RESULTS

Transcriptome divergence between cave and terrestrial populations
We identified 205,604 SNPs that were segregating among our six populations. Fst was calculated over 38,126 intervals (50 bp in length) with at least one segregating SNP from 7366 contigs. These contigs were mapped to 3454 genes with functional annotations. Distribution and average Fst values for population/species pairs are shown in Table 1.

Between species, 2360 of the 50 bp windows had one or more SNPs that were completely fixed and identified as outliers between species (top 5% of Fst distribution: average Fst = 1). These outlier SNPs were in 1756 contigs that mapped to 1239 genes with GO annotations. The outliers had significant GO enrichment in 150 biological processes and 90 molecular functions. Many of the GO-enriched categories were related to functions predicted to be under selection in cave-adapted organisms. Several of these potential genes were involved in metabolic activity (30 genes), adrenal activity (20 genes), pigment synthesis (20 genes) and visual sense (17 genes). We identified outlier water transport genes. In cave wookiees metabolic activity was significantly enriched (three biological processes). We identified multiple retina and lens specific genes of significant enrichment in CW and absent in T1 and T2. Pigment synthesis was significantly enriched in CW (three biological processes, two molecular functions). T1 and T2 transcriptomes revealed several significantly down regulated genes involved in adrenal hormone synthesis (three biological processes). Outlier genes and enriched taxa are listed in table 2.

Divergence between caves populations
To determine which loci evolve quickly between populations due to processes other than adaptation to light and humidity, we compared divergence between our two cave-dwelling populations.

Between our T1 and T2 populations, we identified 402 outlier SNP windows (Fst ≥ 0.321). We found 53 enriched biological processes, 17 cellular components, and 12 molecular functions. In T1 we found unique down-regulation of three genes for retinal synthesis.

Divergence between geographically distinct terrestrial populations
To determine which loci evolve quickly between populations due to processes other than adaptation to caves, we compared divergence between our two most geographically distant W. wookiee populations. We identified 2402 outlier SNP windows (Fst ≥ 0.421). We found 73 enriched biological processes, 13 cellular components, and 16 molecular functions. We found enrichment of two potential epinephrine regulatory biological processes (coupled ATPase activity, protein serine/threonine kinase activity) and one reproductive process (C21-steroid hormone metabolic process). These outliers were removed to control for variation from genetic drift and factors unrelated to habitat adaptation.

Pooled Sequence Divergence versus Individual Sequence Divergence
We found similar levels of divergence between species when comparing W. wookiee and W. troglodytus individuals genotyped on Infinium bead chips (16 W. wookiee, 12 W. troglodytus). Average Fst across 3485 SNPs was 0.386 +/- 0.006, similar to the mean Fst of 0.38 from the pooled analysis (t-test assuming unequal variance: t4, 881 = 0.33, P = 0.74). Between species Fst estimates showed significant positive correlation between pooled and Infinium data (SNPs aligned within 50 bp, Pearson r = 0.49, P < 0.0001, N = 299). Pooled Fst estimates were not significantly higher than individual genotype data. Of the outlier loci between species identified in the pooled analysis 88% also showed high sequence divergence in the genotypes.

Table 2. (Click to enlarge) Summary of gene outliers and GO enrichment between common wookiee (CW) and troglomorph wookiee populations (T1 and T2)

APCMv1p7TABLE02AAPCMv1p7TABLE02BAPCMv1p7TABLE02CAPCMv1p7TABLE02D

CW genotype GO enrichment analysis on Infinium SNP data was compared to pooled sample CW enrichment analysis. Infinium SNP data recovered enrichment of two epinephrine regulatory biological processes and one reproductive process. One thousand Fst outliers (0.3833 ≤ Fst ≤ 0.4016) were identified between CW, T1 and T2 populations using Infinium SNP data that corresponded to 980 genes enriched in metabolic, adrenal, pigment, and vision biological processes. Water transport genes were not enriched in genotype GO analysis.

DISCUSSION

W. troglodytus and W. wookiee live in highly contrasting environments subject to unique selective pressures. These differences were reflected in the genomic data. We discovered many contigs that contained highly differentiated SNPs associated with multiple biological processes that correspond with phenotype. Metabolic, adrenal activity, pigmentation, vision and water transport genes were highly differentiated between transcriptomes of common and cave-wookiees. Genetic outliers identified between species of Wookiee were not identified in interspecies comparisons, thus we feel confident the differences reflect shared, cave- or surface-evolution over variation due to geographic distance and genetic drift.

We suspected some visual genes may be compromised in W. troglodytus, but the quantity (17 genes) was unexpected. Troglomorph wookiees have poor visual acuity compared to surface species, but the acuity is reduced, not non-functional. Complete eye loss is common in troglomorphic species but it has not yet been observed in sentient troglomorphs (Protas and Jeffery 2012). Where eyes are absent, loss has been shown to result from initial eye development halted when retina and retina pigment epithelia (RPE) cells undergo apoptotic cell death (Protas and Jeffery 2012). We are surprised that at least one RPE gene is showing down-regulation across troglomorph wookiees while visual function is still possible. We were also surprised to find two retinal binding proteins and one retinal transfer protein expressed in common wookiees and one population of cave wookiees, and down-regulated expression in one population of troglomorph wookiees.

Multiple metabolic process genes were divergent between W. wookiee and W. troglodytus. Astyanax cave and surface morphotypes showed enriched GO for metabolic processes that were in concert with a physically reduced pineal gland (Gross et al. 2013, Omura 1975). Predictably, outlier genes identified between cave and surface morphotypes were involved in lipid and protein metabolism (Gross et al. 2013). Gross et al. (2013) hypothesized that reduced nutrient and oxygen supply to subterranean habitats may impose selective pressure upon cave morphotypes to evolve more efficient metabolism, which is physically manifested in a smaller pineal gland. Outlier genes between W. wookiee and W. troglodytus were identified in protein, lipid metabolism, and glucose metabolism. We suspect that the enrichment of these genes across W. troglodytus populations represents selective pressure for efficiency in this species as well. However, physical abnormality in the pineal gland has not been observed in troglomorph wookiees.

This analysis revealed, across troglomorph wookiees, three outliers associated with water transport in pooled-sample transcriptomes that were not recovered in individual genotype enrichment analyses. Camellins and BtTp proteins play a crucial role regulating cellular osmotic stress and hypohydraemic metabolism. We did not expect evolution in troglomorph wookiees to be under strong selective pressure for efficient water transport; the cave network habitats are, on average, more humid than surface habitats on Kashykk. It may be that potable water is limited in these caves or that another factor is exerting selective pressure on cellular water transport.

Reductions in pigment gene expression were not surprising. W. troglodytus are readily identifiable by the absence of color in their hair and skin. Our results identify underlying mechanisms of one of the most apparent phenotypic differences among troglomorph and common wookiees. Three biological processes associated with pigmentation were enriched in W. wookiee: melanin biosynthesis, melanocyte mitosis, and melanosome membrane biosynthesis. One of the genes identified in W. wookiee most strongly expressed is BrwnE VA. In albino W. wookiee, the gene is mutated and fails to facilitate chromatin coiling within melanocytes (Peterson and Peterson 2001). Peterson and Peterson (2001) identified non-function tyrosinase genes in melanocytes of albino W. wookiee and Ewok ewok. Melanocytes, where tyrosinase production was limited, formed incomplete membranes. Crucial components of pigment synthesis are compromised in W. troglodytus. We suspect pigmentation genes are mutating under relaxed selective constraints for pigment synthesis among troglomorph wookiees.

Some of the more curious observations of W. troglodytus, recorded by Sphinx et al. 2003 and Spickens (2012), are of their behavior. Fair-minded but excitable, common wookiees interact aggressively to resolve disputes. Wookiee on wookiee violence is less frequent, but not unheard of, and they cooperate to combat threat. Increased cortisol and epinephrine production has been demonstrated in conflicting common wookiees (Grey and Green 1986). Sphinx et al. (2003) and Spickens (2012) noted arguments among troglomorph wookiees conspicuously absent and observed zero incidences of aggressive posturing. Common wookiees are reported to engage in limited social grooming, most often displayed between very young siblings and cousins (Spickens 1979). Spickens (2012) recorded W. troglodytus engaging in social grooming for as many as 8 hours a day. Grooming behavior was observed across ages and genders (Spickens 2012). In common wookiees, social grooming stimulates the release of placidin, a mildly tranquilizing hormone (Grey et al. 1984). Adrenal hormone synthetic processes associated with placidin, cortisol and epinephrine were highly variable between cave-adapted and common wookiees. Among the outliers, cortisol and epinephrine synthetic pathways plus associated proteins were enriched in W. wookiee. Placidin genes were significantly enriched in W. troglodytus. Variation in gene expression across these hormone synthesis processes likely accounts for the unique behavioral adaptations between wookiee species. Increased grooming behavior among troglomorph wookiees may be explained by selective pressure to maintain good hygiene in a humid and dark environment. Alternatively, tactile sense may be elevated in troglomorph wookiees, as non-visual senses are often heightened in the absence of light (Romero 2011). In either case, the behavior is likely reinforced by the pleasant feeling associated with placidin production (Spickens 1979).

CONCLUSIONS

In this report, we present the results of comparative transcriptome analysis between surface and subterranean-adapted wookiee species, W. wookiee and W. troglodytus. Our data uncovered divergence in gene expression between the species that is consistent with observed morphological and behavioral differences. Many of the highly variable genes identified in our research have been indicated as important factors other cave-adapted organisms (Reviewed in Protas and Jeffery 2012). Areas of further research should begin with deeper investigation of vision and endocrine system development between wookiee species and between populations W. troglodytus.

ACKNOWLEDGEMENTS

The authors thank the staff of Unigens for providing ample support in transcriptome analysis (New York City, New York); Q Viceroy assisted with bioinformatics; P Spickens and J Sphinx provided observations and discussion of in situ wookiee populations. The transcriptome sequencing work was approved by the University of British Columbia and was funded by the Universal Humanoid Research Foundation Awards (ZX0-1222 to PCQ). B Wang, T Cheeke and three anonymous reviewers provided helpful comments on the manuscript.

LITERATURE CITED

Akey JM, Zhang G, Zhang K, Jin L, and Shriver MD. 2002. Interrogating a high-density SNP map for signatures of natural selection. Genome Res. 12:1805–1814.

Akey JM, Ruhe AL, Akey DT, Wong AK, Connelly CF, Madeoy J, Nicholas TJ and Neff MW. 2010. Tracking footprints of artificial selection in the dog genome. Proceedings of the National Academy of Sciences USA 107:1160–1165.

Beaumont,M. A., and D. J. Balding. 2004. Identifying adaptive genetic divergence among populations from genome scans. Mol. Ecol. 13:969–980.

Dubois P and Sinclair V. 1990. White wookiee? Abino wookiee sighted in northwest Wawaat. Biological Transactions 10: 12-14.

Grey P, Chan V, Truong K, Lian C. 1983. Placidin: structure and function. Journal of Sentient Endocrinology 281: 64-71.

Grey P and Green V. 1986. In-combat W. wookiee hormone secretion. Journal of Sentient Endocrinology 340: 12-17.

Kofler, R., R. V. Pandey, and C. Schlotterer. 2011. PoPoolation2: identifying differentiation between populations using sequencing of pooled DNA samples (Pool-Seq). Bioinformatics 27:3435–3436.

Kolaczkowski B, AD Kern, AK Holloway, and D Begun. 2011. Genomic differentiation between temperate and tropical Australian populations of Drosophila melanogaster. Genetics 187:245–260.

Kozak GM Brennan RS, Berdan EL, Fuller RC and Whitehead A. 2013. Functional and populational genomic divergence between two species of killifish adapted to different osmotic niches. Evolution 12265. Early view published online 17/10/2013.

Li H and Durbin D. 2009. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25:1754–1760.

Li H, Handsaker B, Wysoker A, Fennell A, Ruan J, Homer N, Marth G, Abecasis G and Durbin R. 2009. The sequence alignment/map format and SAMtools. Bioinformatics 25:2078–2079.

Omura Y. (1975) Influence of light and darkness on the ultrastructure of the pineal organ in the blind cave fish, Astyanax mexicanus. Cell Tissue Research 160: 99–112.

Peterson PA and Peterson Q. 2001. Pigment synthesis pathway in albino W. wookiee and Ewok ewok. Annals of the Kashykk Natural History Museum. 1121: 80-84.

Protas M and Jeffery WR. Evolution and development in cave animals: from fish to crustaceans. WIREs Developmental Biology. 2012. 1:823–845.

Romero A. 2011. The evolution of cave life. American Scientist. 99 (2):144-151.

Tong B. 1994. White wookiees: rare genetic mutation or more than meets the eye? Biological transactions: 18: 56-58.

Turner TL, Bourne EC, Von Wettberg EJ, Hu TT, and Nuzhdin SV. 2010. Population resequencing reveals local adaptation of Arabidopsis lyrata to serpentine soils. Nature Genetics. 42:260–263.

Sphinx J, Truong C, Craveness P, Malcovich J and Shostakovich P. 2003. Northwest Wawaatt populations of apparent troglobite Wookiee wookiee raise questions as to what defines a wookiee. Nature: 389: 43-48.

Spickens P (1979). Urban and rural wookiee (W. wookiee) social behavior. Humanoid Study 4: 47-61.

Spickens P (2012). Species status of cave-wookiee populations based on morphology and DNA. Humanoid Study. 52: 120-128.

Zerbino DR and Birney E. 2008. Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Research. 18:821–829.

About Hayley Darby and Cho Wee

Hayley is a graduate student in the Botany Department at the University of British Columbia. Her long-term goal is to develop a blueberry variety with tomato-size fruit. Cho Wee obtained her PhD from the University of British Columbia in 2012 and has been publishing numerous high impact articles ever since. She is a life-long member of the Interplanetary Scientification Society.

IDENTIFICATION OF HUMAN CHROMOSOME γ AND ITS EPIGENETIC CONTROL FOR THE EXPRESSION OF “SUPER” GENES

By | archive, creative, journal club

NEJMHulkSmurfPopeyepage1

- – -

New England Journal of Medicine. (March 2013). Vol 328 No 12. DOI: 10.1738/NEJMoal219833pdf download

ABSTRACT

BACKGROUND
Superheroes possess exceptional characteristics that far exceed the scope of human capabilities, such as the tremendous strength and pigmentation observed in The Incredible Hulk following his exposure to γ-radiation. Here, we explore the underlying molecular mechanisms for the “superhuman” abilities seen in the Hulk, as compared to semi-superheroes Papa Smurf and Popeye the Sailor. In particular, we examine the role of epigenetic mechanisms, principally DNA methylation, in the genotypic expression of “super” genes and their phenotypic manifestation.

METHODS
Whole Transcriptome Shotgun Sequencing (WTSS) was conducted on The Incredible Hulk, Popeye the Sailor, and Papa Smurf to identify “super” genes. Whole Genome Shotgun Sequencing (WGSS) was subsequently performed on the Hulk, from which chromosome γ was assembled and Bacterial Artificial Chromosomes (BAC) were created. FISH-karyotyping was then employed for chromosome examination before and after treatment with γ-radiation. Methylation assays were conducted on CpG islands upstream of “super” genes to assess gene expression following treatment with activator substances spinach and smurf berries.

RESULTS
Two highly expressed novel genes, Vis and Colos, were identified by WTSS in The Incredible Hulk. Vis was also expressed in Popeye, suggesting that it is associated with superhuman strength, and Colos was also expressed in Papa Smurf, suggesting that it is associated with hyperpigmentation. WGSS revealed that the genes are located on opposite arms of a novel chromosome. This chromosome was confirmed by karyotyping and named chromosome γ. FISH probes revealed that in all cases, save the Hulk, the γ-chromosome was associated with the centromere of the X-chromosome. Treatment of normal cells with γ-radiation caused a dissociation of the γ- from the X-chromosome. In in vitro studies, it was found that concentrated spinach and smurf berries decrease methylation in CpG islands upstream of the Vis and Colos genes, respectively.

CONCLUSION
There exists a novel chromosome, which is somehow intertwined with the centromeric region of the X-chromosome. It contains two “super” genes, for strength and color, which under normal conditions are silenced by upstream CpG island methylation. These genes can be activated by spinach or smurf berry treatment (via CpG demethylation) or by exposure to γ- radiation (via physical separation of chromosome γ from X). This suggests a potential for the discovery of additional “super” genes and chromosomes in association with previously defined chromosomes.

INTRODUCTION

SUPERHEROES POSSESS EXTRAORDINARY OR unusual superhuman powers [1]. It has been proposed that alternative gene regulation or genetic mutations are the root of such exceptional phenotypic abilities [1,2,3]; however, these genotypic abnormalities remain poorly defined. Understanding the molecular mechanisms responsible for expression of “super” genes is pivotal in determining the physiological and cellular features conducive to superhuman abilities.

Epigenetic regulation of gene expression, such as DNA modification, has been shown to direct the transcriptional activity of genes [4-7]. DNA methylation is a common epigenetic marker and plays important roles in the regulation of gene expression, genomic imprinting, X-chromosome inactivation, embryonic development, and cancer5. Methylation of CpG islands upstream of promoter regions by DNA methyl-transferases decreases transcriptional activity of those genes, whereas demethylation increases activity [4,7]. The process of DNA methylation is a dynamic and reversible enzymatic process [8,9].

The Incredible Hulk is a gigantic green human-like antihero possessing incredible strength. He is the transformed alter ego of Dr. Bruce Banner, that is a result of exposure to a “lethal” dose of gamma radiation [10]. Since this initial transformation, Dr. Banner can transform into the Incredible Hulk whenever enraged or endangered [11,12]. The central molecular mechanisms responsible for this dramatic transformation have yet to be determined. Here, we identify a novel chromosome associated with the X-chromosome contain-ing two genes that contribute to the observed Hulk phenotype. We used for comparison two semi-superheroes, Papa Smurf and Popeye the Sailor, who possess similar phenotypes to the Hulk: abnormal color and immense transient strength, respectively.

METHODS

SAMPLE ACQUISITION
Primary B lymphocytes were sourced from cervical lymph node biopsies (performed by A. Y. J.) of four index cases: The Incredible Hulk, Popeye the Sailor, Papa Smurf, and a healthy 42-year-old male human. For the cases of the Hulk and Popeye, two independent biopsies were performed: one during the resting state and (at considerably greater difficulty) one during the peak phase of strength.

CELL LINE GENERATION
B lymphocyte cell lines were generated from all biopsies. B-cells were selected for using CD19 antibody-targeted FACS (BioLegend, cat. 302234) and validated by a hematopathologist (R. D. G.). Cells from Papa Smurf (PS-1), active Hulk (Hulk-1), and active Popeye (PE-1) were found to grow well in 100% heat-inactivated fetal bovine serum (HI-FBS), at 3% CO2 and 42 oC.

In establishing cell lines from the human control (LCL-49), non-active Hulk (NAH-20), and non-active Popeye (NAP-9), transformation with competent Epstein-Barr virus was required. Subsequently, these cell lines were found to grow modestly in 20% HI-FBS RPMI-1640 media (Gibco, cat. 11875-093) containing 1% penicillin/streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, and 0.1 mM non-essential amino acid at 5% CO2 and 37 oC. After ~5 passages, cell lines LCL-49, NAH-20 and NAP-9 were found to either no longer to exhibit B-cell characteristics or be competent.

PREPARATION OF NUCLEIC ACIDS
Both DNA and RNA were extracted from all cell lines using Qiagen’s Allprep Mini kit (cat. 80004). cDNA was synthesized using the Invitrogen Super-Script III Reverse Transcriptase kit (cat. 11754-050).

WHOLE-TRANSCRIPTOME SHOTGUN SEQUENCING OF HULK cDNA
WTSS was performed as previously described [12]. Briefly, this involved the synthesis of cDNA from transcript RNA, the sonic shearing of cDNA to produce fragments <300 bp in size and the amplification of products 32,768-fold, by means of the Illumina Genome Analyzer paired-end library protocol. The generated library was sequenced using an Illumina Genome Analyzer IIX.

Reads were aligned to the NCBI build 36.2 hg19. Those reads not aligning to hg19 were binned and aligned using the Cufflink algorithm (from Tophat, version 2.0.2) which is also capable of calculating transcript abundance in addition to assembling reads de novo.

WHOLE-GENOME SHOTGUN SEQUENCING OF HULK γDNA
WGSS was performed as previously described [13]. 1 µg of genomic DNA was shredded and size-selected for sequences <400 bp. Barcode and priming sequences were annealed to the size-selected DNA prior to 10 cycles of amplification observing the Illumina PCR protocol. The Hulk genomic library was run on an Illumina HiSeq 2500 (16 lanes for >2,000 x coverage).

As with the WTSS, reads were aligned to hg19. Non-aligning straight and paired-end reads were analyzed with the assistance of the Wang group for the assembly of chromosome γ [14].

FISH-KARYOTYPIC ANALYSIS
From the WGSS analysis, novel BAC probes were generated, as previously described [15], to include ~100 kbp sequence upstream of Vis and Colos (see Fig. 1). Samples from all cell lines were subsequently M-phase methotrexate-synchronized, ~105 cells were fixed to slides, and probes were hybridized according to the Genetic Pathology Evaluation Centre protocol [16]. Chromosomes were visualized using a Zeiss automated microscope with analysis software (CytoVision) from Ariol.

figure01hulk
Figure 1: WGSS sequencing the Hulk. Both genes were found to be one exon is size and Colos (751 bp) as presented is relative in size to Vis (802 bp). Approximate paired-end read support is provided in blue (Vis = 27 reads, Colos = 21 reads), while the full length read support is provided in red. Split and full-length reads are not to scale. Newly generated BAC probes (RPCI-1A1 and RPCI-2AB) are mapped relative to Vis and Colos exons.

IN VITRO γ-RADIATION
Cell lines were exposed to gamma-radiation in increments of 50 Gy (10-510 Gy). A Gammacell 220-cobalt-60 device (Atomic Energy of Canada Limited), producing 30 Gy/min, was used to generate γ-radiation [17]. Following this exposure, a FISH-karyotypic analysis was performed, as described above.

METHYLATION ASSAY
Spinach purée was generated by means of dicing and steaming 50 kg of spinach for 5 hours at 60 oC and 10 PSI. The resulting purée was subject to 47 rounds of repeated filtration and evaporation to distill to a concentrate of 2 ml. This protocol was observed to generate 2 ml of smurf berry concentrate, using 7 rounds of repeated filtration and boiling. A co-culture treatment matrix was then devised to expose 2 million cells (enumerated via Invitrogen’s Countess device) from each cell line to spinach and smurf berry concentrate (ranging from 100-2000 µl of concentrate per 10 ml culture). Cells were co-cultured for 1 hour in respective concentrates at ideal growth conditions, after which genomic DNA was harvested as before.

1 μg genomic DNA from each cell line treatment was bisulfate-converted using the EZ DNA Methylation kit from Zymo Research (cat. D5002). In working with Affymetrix, a novel chip was developed for the γ-chromosome to which genomic DNA containing the CpG islands upstream of Vis and Colos would hybridize, depending on the degree of methylation. This novel methylation chip and accompanying protocol will be available for purchase from Affymetrix in April of this year. Signals were detected using the Aerius Automated Chip Imaging System and analyzed using APT (version 1.14.3).

RESULTS

IDENTIFICATION OF VIS AND COLOS
WTSS of Hulk-1 (active Hulk) revealed exceedingly high expression of two previously non-described genes, neither of which was present in the non-active or human control lines (LCL-49, NAH-20, or NAP-9). One of these two genes (751 bp) was found to have high homology with a new gene identified in PE-1 (active Popeye), so we have presumed them to be orthologs of the same gene. This gene, henceforth called Vis, is likely responsible for the phenotypic super-human strength exhibited by both the Hulk and Popeye. Relative differences in strength between the two cases may be accounted for by polymorphisms within the sequence. The second new gene found in Hulk-1 (802 bp) was shown to have high homology with a gene identified in PS-1 (Papa Smurf). These were also presumed to be orthologs of a gene, henceforth called Colos, which is likely responsible for the intense hyper-pigmentation of both the Hulk and Papa Smurf. Again, polymorphisms may account for variation in their exact coloring.

WGSS of the Hulk genome resulted in the de novo assembly of a novel chromosome on which both Vis and Colos reside. The two genes were found to be singly exonic and on opposite arms of the chromosome.

IDENTIFICATION OF CHROMOSOME γ
Karyotypic analysis of Hulk-1 (Fig. 2a,b) revealed a collection of fragmented chromosomes (an artifact of the Hulk’s exposure to γ radiation), along with the presence of an entirely new chromosome, which we have named chromosome-γ. Both Vis and Colos localized to the γ-chromosome by FISH analysis. Contradictorily, in both PE-1 (Fig. 2c) and PS-1 (Fig. 2d), Vis and Colos localized to the X-chromosome.

Figure02hulk
Figure 2: FISH-Karyotypic analysis of the X-, γ- and hybrid chromosomes in the Hulk, Popeye and Papa Smurf. Hulk X-chromosome (a), Hulk γ-chromosome (b), Popeye X/γ-chromosome (c), and Papa Smurf X/γ-chromosome (d). Red signals depict Vis and green signals depict Colos. Chromosomes are derived from M-phase cells.

γ-irradiation and subsequent karyotyping of non-Hulk cell lines revealed the de-localization of Vis and Colos FISH signals from the X-chromosome to a now-independent chromosome-γ. We hypothesize that in normal tissues, the γ-chromosome is somehow intertwined with the centromeric region of the X-chromosome. This physical intertwining may account for previous failure to detect and sequence this chromosome. We further hypothesize that the γ-irradiation-induced dissociation of γ- from X- may arise from breakages within the telomeric region of the γ-chromosome. The discovery of this intertwining capability of chromosomes may have implications for further genomic discovery of small chromosomes associated with centromeric regions of larger chromosomes.

EPIGENETIC ANALYSIS
Hulk-1 maintained low levels of methylation in CpG islands upstream of both Vis and Colos before and after treatment with either of the two activating substances (Fig. 3a,b). Similarly, PE-1 retained low methylation upstream of the Vis gene only with and without treatment with spinach (Fig. 3a), and PS-1 had low methylation upstream of the Colos gene with and without treatment with smurf berries (Fig. 3b).

Figure03hulk
Figure 3: Methylation of CpG islands upstream of “super” genes. Normalized methylation levels of CpG islands upstream of Vis gene for strength (a) and Colos gene for color (b) following treatment with smurf berry or spinach concentrate, or untreated media. Results are shown for active and inactive Hulk, active and inactive Popeye, Papa Smurf, and human control.

In cells other than Hulk-1 and PE-1, the methylation state of CpG islands upstream of the Vis gene decreased significantly following treatment with high-dose spinach extract (Fig. 3a). Likewise, the methylation state of CpG islands upstream of the Colos gene dropped significantly following treatment of cells (other than Hulk-1 and PS-1) with low-dose smurf berry extract (Fig. 3b). Since decreased methylation of upstream CpG islands is linked to increased expression of genes [18,19], we speculate that both of these activators induce expression of their respective “super” gene by the action of a DNA methyltransferase. Further study is required to determine the sources and activation of these methyltransferases.

We can provide some suggestions for the discrepancies in modes of stimulation for our index superhero and semi-superhero cases. Smurfs live in seclusion [20] and have restricted, exclusive access to smurf berries [21] so it follows that their effects on the Colos gene are only seen within this closed population; however, spinach is a widely available commodity that is often consumed as part of a regular diet. We hypothesize that the effects of spinach on Vis are only stimulated at extremely high concentrations, well-beyond the lethal dose of iron for humans.

Popeye must bear some genetic aberration that supports a mechanism for survival of such a high dose of iron, such as a transport enzyme or metal chelator. Since the Hulk does not regularly consume either of the activator substances, we suggest that though his exposure to γ radiation has caused dissociation of the γ-chromosome from the centromere of the X- chromosome, it is only partial. The two must be further separated by some physical force, such as increased blood pressure, for the γ-chromosome to become fully active.

FUTURE DIRECTIONS
In order to understand the mechanism by which activator substances function to initiate expression of “super” genes, a full protein interactions model must be constructed. The elucidation of this pathway may promote the discovery of additional centromere-associated, novel chromosomes. This unexplored mechanism of gene regulation could be pivotal in our understanding of superhuman powers and their molecular backgrounds.

Findings from this study may be employed for curative purposes to Dr. Bruce Banner, such as si-RNA treatment or use of small inhibitors against downstream proteins.

No potential conflict of interest relevant to this article is reported.

Disclosure forms provided by the authors are available with the full text of this article at NEJM.org.

We thank Nobel Prize Laureate Dr. Dave Ng for his support.

REFERENCES

1. Lee S. The history and future of superhuman abilities. Annu Sup Rev 1973;3:33-45.

2. Siegel J and Schuster J. Genomic mutations may be behind superhe-roic abilities. DC Rev 1960;22:63-9.

3. Lee S. Unusual abilities resulting from radiation induced mutations. Sup Biol 1977;33:13-20.

4. Jaenisch R, Bird A. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet 2003;33:245-54.

5. Schafer A, Karaulanov E, Stapf U, Döderlein G, and Niehrs C. Ing1 functions in DNA demethylation by directing Gadd45a to H3K4me3. Genes and Dev 2013;27:261-73.

6. Larochelle S. Directing DNA meth-ylation. Nat Struc and Mol Biol 2013;20:308.

7. Jones P, Takai D. The role of DNA methylation in mammalian epige-netics. Science 2001;293(5332):1068-70.

8. Niehrs C. Active DNA demethylation and DNA repair. Differentiation 2009;77:1–11.

9. Schär P and Fritsch O. DNA repair and the control of DNA methylation. Prog Drug Res 2011;67:51-68.

10. Lee S. Characterizing the Hulk. Sup Biol 1974;30:21-6.

11. Lee S. Investigating the transform-ation of the Hulk. Marv Biol 1970;8:31-9.

12. Shah, S, et al. Mutational evolution in a lobular beast tumour profiled at single nucleotide resolution. Nature 2009;461:809-13.

13. Morin, R, et al. Somatic mutations altering EZH2 (Tyr641) in follicular and diffuse large B-cell lymphomas of germinal-center origin. Nat Gen 2010; 42:181-5.

14. Li, R, et al. De novo assembly of human genomes with massively parallel short read sequencing. Genome Res 2010;20:265-72.

15. Osoegawa K, Woon PY, Zhao B, Frengen E, Tateno M, Catanese JJ, and de Jong PJ. An improved approach for construction of bacterial artificial chromosome libraries. Genomics. 1998;52(1):1-8.

16. FISH protocol for Paraffin Em-bedded Tissue. Vancouver, BC.: Genetic Pathology Education Centre, 2009. (Accessed March 21, 2013, link)

17. Getoff, N, et al. Formation of sex hormone transients resulting from attack of free radicals. Anticancer Res 2013;33:941-7.

18. Razin A. CpG methylation, chromatin structure, and gene silencing — a three-way connection. EMBO J 1998;17;4905–4908.

19. Cameron E, Bachman K, Myöhänen S, Herman J, and Baylin S. Synergy of demethylation and histone deacetylase inhibition in the re-expression of genes silenced in cancer. Nat Gen 1999;21:103–107.

20. Banfly A, VanDeely F, Shaw S, and Culliford P. Observations of Smurfs in their Natural Habitat. Spirou Mag 1959;5:32-37.

21. Tressens D, Sagely K, Staffords J, and Culliford. Exploration of the Smurf Diet. Spirou Mag 1962;1:12-23.

About Amanda Dancsok, Yuda Shih, and David Twa

Amanda Dancsok is a Saskatchewan-born MD/PhD student at UBC studying experimental therapeutics for rare soft tissue cancers. Yuda Shih is a second year Master's student in the Department of Pathology and Laboratory Medicine. His research interests include signaling mechanisms that promote myelination in the central nervous system. Dave enjoys passaging cells, filling out graduate fellowship applications that he has a statistically significant (P<0.05) probability of not winning, troubleshooting, troubleshooting and troubleshooting. Every third full moon from 11:00-11:16pm, he very occasionally engages in something which might resemble research, but only if Mars lines up with one of Jupiter’s moons and the tide is out.

UPREGULATED MEMBRANE EXPRESSION OF A CONSERVED VOLTAGE-GATED SODIUM CHANNEL, Nav1.4a AND ELECTRICAL ORGAN DISCHARGE IN ELECTRIC MOUSE, P. pikachu

By | archive, journal club

paperfrontpikachu

- – -

PLOS BIOLOGY (March 2013). Vol 11 Issue 3. e1001501 p1-6 pdf download

ABSTRACT

Electrocytes contain membrane proteins that allow the polarization of the plasma membrane, thereby allowing the generation of electricity in animals. It has been long established how electricity is generated in the electric eel, but recent studies found similar electrocytes to be active in electric mice. We aimed to study the basis behind electric discharge in a land animal. We found that the voltage-gated sodium channel, Nav1.4a, was expressed in electric organs of the electric mouse, Pokemon pikachu and the electric eel, Electrophorus electricus. However, Nav1.4a was not expressed in the muscle cells of E. electricus while it was expressed in the muscle cells of P. pikachu and other rodents. We also found that P. pikachu and E. electricus shared similar amino acid substitutions at the nonconserved region of this protein. Voltage-clamp technique gave insight on the much greater potential differences generated by P. pikachu compared to electric eel and finally, microscopy analysis revealed greater Nav1.4a numbers in P. pikachu, potentially correlating with aforementioned greater electric potential generation, which perhaps lead to its capability to discharge electricity readily through air.

AUTHOR SUMMARY

Many species of fish are able to generate weak or strong electric discharges, either for communication or for stunning predator or prey. The electric organ, made of electrocytes, is responsible for generating electric discharge. Electrocytes are thought to be derived from neuronal and muscle cells. The voltage-gated sodium channel, Nav1.4a, is found to be absent in the muscle cells, but is highly expressed in the electric organs of electric fishes. In our study, we looked at Nav1.4a in a species of mouse, P. pikachu, that also generates electricity, but through air instead of water. We compared this electric mouse with electric eel as well as nonelectric rodents. Here, we found that Nav1.4a is expressed in both the muscles and electric organs of P. pikachu. In terms of the amino acid sequence, the channel protein of P. pikachu was more similar to the electric eel rather than the rodents. We then observed that P. pikachu possessed much greater numbers of Nav1.4a and generated a much higher potential compared to the electric eel, which may explain its ability to discharge electricity through air.

INTRODUCTION

The nervous and muscular systems developed shortly after the appearance of the first multicellular organisms, approximately 650 million years ago [1] . In animals with a nervous system, the neurons generate action potentials (AP) and form circuits: furthermore, they possess the capability of releasing neurotransmitters, innervating muscles and directing behaviour [2]. The foundation of electrical excitability in animals is built upon the voltage-gated ion channel. The simplest forms, which include potassium leak and voltage-dependent (K+) channels, appeared 3 billion years ago in bacteria and exist in all organisms today [3]. Voltage-gated ion channels provide a resting potential and repolarize membranes that have been excited. These simple ion channels have, however, evolved further from the six transmembrane (6TM) helices K+ channels into 4x6TM channels, obtaining Ca2+ permeability along the way. From there, Voltage-gated Na+- permeable channels then evolved. Nav channels are the basis for electrical excitability in animals [2].

The polarization of membranes is indeed key to animals that generate electricity. Cells called electrocytes have evolved key muscle membrane proteins that polarize the plasma membrane. The electric tissue in these animals contain membrane proteins that are homologous to those found in other excitable tissues, and especially in the electric eel where electric tissues are invaluable for studying membrane excitability. The electric eel, Electrophorus electricus, is capable of generating electrical potential of up to 600 volts by means of its three well-defined electric organs. The main organ generates high voltage discharges and runs from the viscera of the eel down to the tail, while the adjacent organs emit low electric charges and probably serve in facilitating the eel’s sense of electrolocation [4].

Columns of cells run the length of the main organ and are separated by electrically insulating septa. Electrocytes themselves are multinucleated syncytia, which are stacked one after another to make up those aforementioned columns, thereby allowing the production of pronounced fluctuation in membrane potential. Figure 1 displays an example of how electrocytes are stacked and cumulatively produce a higher potential. We assume a similar set up for electric mice, except that the current circuit is closed by flowing through the air. The lower conductance of air in electric mice led us to study the key difference that allows Pikachu to do so.

Figure01pikachu

Figure 1. [Click Image to Enlarge] Physiological basis of electric organ discharge (EOD). Electrocytes are stacked together in series. The simultaneous stimulation of the electrocytes allow the transcellular potentials to summate. One electrocyte in E. electricus produces a intracellular potential of 150 mV. By stacking in series, potentials summate over the electrocytes. In this figure, three electrocytes of E. electricus build up to a cumulative transcellular potential of 450 mV. For electric fish, the current flows in posterior to anterior direction, and the circuit is closed by flowing out of the water, back to the tail. Derived from Bennet et al, with permission [4].

Over the past few decades it has been reported that certain mouse strains are also capable of generating electricity in a similar fashion to the E. electricus [5]. The most prominent of which is the species of mouse Pokemon pikachu, which has already been the subject of several other studies. Ash Ketchum et al [6]. have shown the existence of electric organs in P. pikachu’s cheeks and tails, where stacks of electrocytes have been found. This has prompted our research group to further investigate P. pikachu’s electrocytes to look for a common ancestral line from which mouse and eels separate. More specifically, we are interested in the Nav1.4 gene that is conserved in the electric mouse and thus, we compare sequences to possibly find homologues between mouse and eel Nav1.4 gene and how the difference contribute to the gene’s function (especially regarding the fact that electric mouse is able to generate electricity on land). Further, we investigate how the Pikachu electrocytes generate the more massive amounts of electricity in comparison to electrophorus electricus and we look at the voltage production by means of voltage-clamp technique. Finally, we are interested in comparing the cell morphology, using confocal microscopy imaging, to provide an answer whether cell size plays a role in electric mice generating higher voltages.

RESULTS

Nav1.4a is expressed in the muscles and EO of P. pikachu

To assess whether Nav1.4a is also expressed in the EO of P. Pikachu, we first measured its transcript levels of Nav1.4a in EO and muscles, and compared that with the transcript levels in E. electricus (Fig. 2A). As we predicted, like E. electricus, Nav1.4a was highly expressed in the EO of P. Pikachu. Studies using ELISA are in agreement with this finding (Fig. 2B). Previous studies have shown that Nav1.4a expression is lost in the muscles of many strains of electric fish, presumably in exchange for its expression in the their dedicated EO [7]. This is consistent with the low levels of Nav1.4 we observed at the transcript and protein levels of muscle tissues in E. electricus. Interestingly, while highly expressed in the EO, Nav1.4a of P. Pikachu was expressed at a level comparable to that of two other rodents, Rattus novigicus and Mus musculus (Fig. 2A). This suggests that phenotypically, Nav1.4a of P. pikachu resembles both electric fishes and rodents.

Figure02pikachu

Figure 2. [Click Image to Enlarge] Comparison of Nav1.4a expression in muscle and EO across four species. A. Relative Nav1.4a mRNA abundance measured by qRT-PCR. Each sample was normalized to beta-action. B. Relative abundance of Nav1.4a protein measured by ELISA. N=5. Ee, Electrophorus electricus; Mm, Mus musculus; Rn, Rattus norvegicus; Pp, Pokemon pikachu.

Nonconserved amino acid sequences in the Nav1.4a of P. Pikachu are similar to the E. electricus variant

Next, we compared the amino acid sequences of the Nav1.4a of the four species. Overall, the majority of the regions contained conserved amino acid sequences for the four species (data not shown). This is in agreement with previous studies, which have shown that a large portion of the protein contain conserved sequences [7]. It has been suggested that evolution acts to maintain this conservation, as amino acid substitutions in many regions critical for fundamental properties of Na channels lead to often fatal neuromuscular diseases in human [8-9]. We zoomed in our analysis on four intracellular loops located in Domain II, Domain III, and between Domain III and IV (Fig. 3A). These loops have been shown to play roles in sodium channel inactivation, a vital step in the cell electrophysiology and also a determinant step of rate of inactivation [10].

The Glycine to Cysteine substitution in the S4-S5 loop in Domain II creates an additional disulfide interaction, which may affect the conformational changes of the sodium channel (Fig. 3B). For the S4-S5 loop in Domain III, an Asparagine residue is highly conserved for mammals, which forms part of the receptor for inactivation. In both E. electricus and P. pikachu, this residue is replaced with positively charged Arginine and Lysine. There is no evidence showing phenotypic consequences for differences between an Arginine or a Lysine residue Substitution for the highly conserved Proline with Cysteine in the interdomain linker has been shown to perturb channel inactivation in rats [8]. Overall, the amino acid sequence at the intracellular loops for P. pikachu resembled more of E. electricus than the rodents, which are the perceived closer relatives to pikachu.

Figure03pikachu

Figure 3. [Click Image to Enlarge] Comparison of interspecies amino acid sequence of Nav1.4a. A. Schematic drawing of the domains of Nav1.4a. B. Four variable regions of the peptide (S4-S5 linker of Domain II, S4-S5 linker of Domain III, two interdomain linker of Domains III-IV) were compared in greater detail. Ee, Electrophorus electricus; Mm, Mus musculus; Rn, Rattus norvegicus; Pp, Pokemon pikachu.

Individual electrocytes from P. pikachu generates greater transcellular potential compared to E. electricus

Since Nav1.4a proteins between E. electricus and P. pikachu are similar in terms of amino acid sequence, we next sought to study the physiological property of individual electrocyte isolated from E. electricus (Fig. 4A) and P. pikachu (Fig. 4B). Potential Difference in individual electrocytes were analyzed. Two pieces of information were generated from Fig. 4. The first information was that Potential Difference generated from P. pikachu electrocyte was on average 865 mV which was 4.7 times higher than what E. electricus electrocytes generated (150 mV). The second information is that there was a 10-fold difference in electric discharge duration between P. pikachu (0.01 s) and E. electricus (0.1 s). This data indicates that pikachu’s electrocytes generate higher electric potential difference in a higher frequency than E. electricus.

Figure04pikachu

Figure 4. [Click Image to Enlarge] Time-dependent electric potential difference in individual electrocytes. A. Measurement of potential difference across electrocytes in E. electricus. B. Measurement of potential difference across electrocytes in P. pikachu. Representative measurements from one electrocyte from each species are shown. Other data not shown. Measurements were repeated for 20 electrocytes per species.

Nav1.4a is highly expressed on the membranes of the electrocytes of P. pikachu compared to E. electricus

We next sought to determine the cause for the greater transcellular potential and frequency of EOD of P. pikachu compared to E. electricus. EO from both species were isolated and immunostained for Nav1.4a. Using confocal microscopy, the image sections containing ion channel-rich side of the membrane were analyzed. Fig. 5A shows the representative confocal microscopy image of electrocytes from E. electricus and Fig. 5B for P. pikachu after immunostaining. The stained area were normalized with the nuclei counts for quantification. Electrocytes from P. pikachu had significantly greater amounts of stained area per nuclei, indicating that at the single cell level, the electrocytes of P. pikachu contained more membrane-bound Nav1.4a than E. electricus.

Figure05pikachu

Figure 5. [Click Image to Enlarge] Immunostaining of Nav1.4a in E. electricus and P. pikachu. A. Representative confocal microscope images of the two species at 20X magnification. Blue: nucleus; Red: Nav1.4a. B. Image-based quantification. Following color segmentation, the area of red was normalized to the number of nuclei present. For the box plot, the lower whisker, lower box, upper box, and upper whisker each represents the 1st to 4th quartile of the obtained data set. N=20

DISCUSSION

While the existence of mice, with EO, possessing the capabilities of generating electric discharges had been identified decades earlier, the mechanism behind electric discharge through air was poorly understood. We began our study focusing on a voltage-gated sodium channel protein, Nav1.4a, which was expressed in the EO of all known marine electric organisms. We found that Nav1.4a was also expressed in the EO of P. pikachu, located at its cheeks and tail. Interestingly, while electric fishes have lost the Nav1.4a expression in the muscle cells, P. pikachu maintains its expression. Therefore from the standpoint of tissue-specific expression, P. pikachu shares both the characteristics of an electric fish as well as its closely-related rodents. In the case of electric fish, by losing ion channel expression in muscle they have sacrificed some functions of their muscle in return for the greater benefit of electrocommunication and attacking predators or preys through electric discharge. P. pikachu resides in areas where there is high competition for physical fitness, required for constantly battling other species. Therefore, it is not illogical that P. pikachu has been selected to possess both phenotypes – maintaining the motility of a rodent with gained ability to generate electricity.

The analysis of amino acid substitutions confirmed that the Nav1.4a channels in the EO of P. pikachu are more similar to other electric fish, and less similar to the rodent families. The amino acid substitutions shared by P. pikachu and E. electricus are mostly at regions associated with channel inactivation. This perhaps shapes the difference between the ion channels functioning as a mode for relaying information in the body versus a mode for generating electricity.

The sequence similarity between the Nav1.4a in P. pikachu and E. electricus, however, would not explain how one is able to induce electric discharge over air while the other is limited to water. Therefore, functional studies on individual electrocytes were performed to measure the differences in the potential generated by EO in P. pikachu and E. electricus. We have observed that the electrocytes for P. pikachu generated much greater trancellular potential at a higher frequency. Immunostaining was then performed to confirm that P. pikachu electrocytes have far greater abundance of Nav1.4a. It is possible that by having more sodium channels, a greater amount of sodium ions enter the electrocytes once signaled, leading to a faster ion influx, resulting in higher frequency, as well as greater ion influx, and resulting in higher potential. The possible consequence of having electrocytes each generating a transcellular potential of nearly 1 V is that, summed together, the entire EO of P. pikachu may generate up to thousands of voltages of electricity. It may be this high magnitude of voltage that allows this strain of electric mouse to discharge electricity through air.

Future work would revolve around confirming some of the hypotheses stated above. We will first need to determine whether there is a direct correlation between the number of Nav1.4a and the transcellular potential. One way to test this is to treat electrocytes with small molecule inhibitors of sodium channels, at various dosages, and measure whether there are changes in potential associated with the treatment. Secondly we will need to study the physiology of the EO of P. pikachu as a whole. It is possible that the surrounding matrix, or supportive tissues in P. pikachu are allowing for the generation of greater potential. Nevertheless, our work has created a potential link between the molecular biology of marine electric fish and an electric mouse. This may open new fields of research on electric mouse using methods previously developed for electric fish.

MATERIALS AND METHODS

Nucleic acid extraction

Electric organs from the electric eel (Electrophorus electricus) and Pikachu (Pokemon pikachu) were extracted. Neighboring muscle tissues from brown rat (Rattus norvegicus), house mouse (Mus musculus), and Pikachu were extracted. Total RNA were isolated from muscles and electric organs in all species using the miRNeasy mini kit (Qiagen).

cDNA synthesis and qRT-PCR

Random hexamers were used to reverse transcribe the extracted total RNA into cDNA using the SuperScript III first-strand cDNA synthesis kit (Life Technologies). Real-time PCR was performed with Nav1.4a-specific primer/probe set (Universal Probe Library #14, Roche), using the Taqman chemistry (Life Technologies). Beta-actin-specific primer / probe set (Universal Probe Library #64, Roche) was used as endogenous control.

ELISA Assays

Muscle tissues and electric organs were collected from electric eel, mouse, rat, and Pikachu. Levels of Nav1.4a protein in these tissues and organs were determined using ELISA assay kits from SABioscience according to the manufacturer’s instructions.

RNA-Seq and in amino acid sequence

The cDNA obtained from the previous step were also used for RNA-seq. Barcoded fragmented cDNA libraries were prepared using the TruSeq RNA Sample Prep Kit (Illumina). The libraries were then pooled and sequenced on a MiSeq sequencer with MiSeq Reagent Kit v2 – 300 cycles Kit (Illumina). The obtained sequences are then demultiplexed and joined to recreate the full cDNA sequences of Nav1.4a. In silico translation was performed from the cDNA sequences, using ExPASy translate tool, to obtain the amino acid sequences for each species.

Measurement of transcellular potentials

Electrocytes were isolated and were mounted in a Lucite holder in which the cell separates two pools of a modified Ringer’s solution (containing 165 mM NaCl, 2.3 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 1.2 mM K2HPO4, 0.3 mM KH2PO4, 10 mM glucose, pH=7.1). The electrocytes are placed on the holder horizontally, innervated side down, and part of the innervated membrane, exposed through a window (3 X 0.7.5 mm), is in contact with a stream of fresh solution. The rate of flow was such that the solution bathing the innervated side could be changed in a few seconds. Potential differences across either membrane were measured between an intracellular glass microelectrode filled with 3 mM KCl and agar bridges in the outside solutions. Electric potential was calculated through equations established previously [11].

Immunostaining and Confocal Microscopy

Electrocytes from electricus and pikachu were mounted onto glass sides and fixed with 0.4% paraformaldehyde. 10% BSA-PBS was used to block the specimen for 20 min. Goat anti-Nav1.4a antibody (Novarus) was applied at 1:100 at room temperature for 1 hour. After 3 x 10 min washes with PBS, Texas Red-conjugated rabbit anti-goat antibody was applied at 1:1000 at room temperature for 1 hour. DRAQ5 nuclear stain was applied at 1:10,000 for 10 min prior to mounting the coverslip. Stained slides were imaged using a confocal microscope (Nikon). Z-stacks corresponding to different vertical sections of the specimen were imaged. The Otsu’s image-based segmentation method was used to quantify stained nuclei and Nav1.4a area.

REFERENCES

1. Love GD et al (2009) Fossile steroids record the appearance of Demospongiae during the Cryogenian period. Nature 457:718-721.

2. Zakon HH (2012) Adaptive evolution of voltage-gated sodium channels: the first 800 million years. Proc Natl Acad Sci U S A 109 Suppl 1:10619-10625.

3. Anderson PAV, Greenberg RM (2001) Phylogeny of ion channels: clues to structure and function. Comp Biochem Physiol B Biochem Mol Biol 129:17-28.

4. Bennet MVL (1971) Electric organs in Fish. Physiology 5:347-491.

5. Haruka M et al (2001) Generation of electricity in mouse strain Pokemon pikachu. Natural 8921:123-145.

6. Ketchum A et al (2000) Identification of electric mouse. Natural 8890: 133-139.

7. Zakon HH et al (2006) Sodium channel genes and the evolution of diversity in communication signals of electric fishes: convergent molecular evolution. Proc Natl Acad Sci U S A 103:3675-3680.

8. Tian XL et al (2004) Mechanisms by which SCN5A mutation N1325S causes cardiac arrhythmias and sudden death in vivo. Cardiovasc Res 61:256-267.

9. Kellenberger et al (2997) Molecular analysis of potential hinge residues in the inactivation gate of brain type IIA Na+ channels. J Gen Physiol 109:607-617.

10. Numann R et al (1991) Functional modulation of brain sodium channels by protein kinase C phosphorylation. Science 254:115-118.

11. Karlin A (1967) Permeability and internal concentration of ions during depolarization of the electroplax. Proc Natl Acad Sci U S A 58:1162-1167.

Acknowledgements
We thank Francisco Bargala, John Avise, and Georg Strieter for providing previous tissue materials from Pikachu. Thank you also to Francisco Bargala for facilitating the dinner conversation with excellent wines from his vineyards.

Author Contributions
The author(s) have made the following declarations about their contributions: Conceived and designed the experiments: MA CS NL. Performed the experiments MA NL. Analyzed the data: CS NL. Wrote the paper: MA CS NL.

Download full pdf here

In case it wasn’t clear already, this article is not real.

About Melissa L. Amrein, Charles Soong, and Ningjian Liang

Melissa Lee Fen Amrein is doing a MSc. at ETH Zurich, Switzerland. Charles Soong a PhD student in the Department of Pathology at the University of British Columbia, studying cancer genomics and DNA repair. Ningjian Liang is PhD. candidate in the Department of Food, Nutrition and Health at the University of British Columbia.