journal club

TATOOINE INTERGOVERNMENTAL PANEL ON CLIMATE CHANGE ASSESSMENT REPORT 1: SUMMARY FOR TATOOINE POLICYMAKERS

By | archive, creative, journal club

I’ve wanted to do this for a while now.

In essence, for the last 5 or so years, Tatooine’s binary star system has come up as a talking point in one of my climate change science classes (yes, I’m a Star Wars fan). Basically, I use it to showcase an over-the-top example of radiative forcing. If you’re not familiar with this term, it’s basically a metric used to calculate net energetics in climate systems (expressed in Watts per square metre). For example, you can use it to measure how our pesky greenhouse gases contribute a positive radiative forcing by keeping heat energy within the Earth’s atmosphere; or how having an extra star would also definitely result in a significant positive RF effect.

Anyway, I guess in the back of my mind, I always thought it would be kind of fun to produce a comprehensive mock Intergovernmental Panel on Climate Change (IPCC) report, with a focus on our favourite desert planet Tatooine. Here, I would essentially use the exact IPCC text, but with some minor changes as well as modifying some of the figures so that they identify better with the Star Wars universe. Add to that, I thought it would be fun to incorporate an analogous anthropogenic emissions narrative: in this case, switch fossil fuel emissions due to our consumption needs and big oil antics, for increases in atmospheric water (also a greenhouse gas) due to unregulated for-profit water mining/extraction, and PUNCH IT CHEWIE, you have a desert planet in climate crisis!

All the more geeky when you consider I’ve specifically added a section on biodiversity effects (essentially, bye bye poor Sarlaccs), and have maintained the general tone of the IPCC which steadfastly avoids any political finger pointing (although, I’m sure it wouldn’t be difficult to come up with an intriguing narrative or two blaming the Hutts or even the Empire).

And why all the effort? Well, firstly, this stands as an admittedly elaborate teaching prop; but secondly, I hope this document entices folks to learn more about the real IPCC report. I get the sense that very few people have even heard of the IPCC, and maybe this even includes yourself. Which is a shame because it’s kind of important. In brief, it’s a document, organized by the United Nations, and prepared by a massive group of academics to try and objectively summarize all available research on climate change and its possible downstream effects. In other words, it’s the summation of decades of work by tens of thousands of very smart people, who are essentially telling you: (1) what the scientific evidence currently looks like; (2) what you might expect to happen in the Earth’s near future; and (3) what should people in influence (i.e. governments) consider doing in order to mitigate or adapt to these projections. Put another way, it’s definitely worth a few moments of your time, even if it is a bit of a sobering read.

All to say that if you think this Tatooine TIPCC document was kind of fun to look over (and note that Figure SPM.6 is probably the geekiest thing here), then I encourage you to take a peek at the real IPCC. There’s even official “easier to read” versions (the Summary for Policymaker files, or SPMs) for the two sections so far released. Do check them out by clicking 1 and 2.

(I should also note that this TIPCC document was put together relatively hastily. Most RF, temperature and emissions calculations were done “back of a napkin” style and obviously are hardly rigorous, if not prone to error (the expected RF variation due to a binary system for instance is something I have no clue about!) For that reason, I’m including links to the word doc, as well as a zipped keynote file used to make or tweak the diagrams. If you want to make the data more “robust,” or even add sections to the document, please do so, and add your name to the authorship section at the beginning).

- – -

TIPCCfront.001
(Click on image to download TIPCC pdf)

Drafting Authors:
R1-G4, R2-D2, IT-O, A4-D, R-3PO, 4-LOM, R2-Q5, R2-R7, R2-Q2, TX-20, FA-4, R4-P17 R4-P44 R4-G9 R4-D5 R5-D4 R5-J2 R7-A7 R7-D4, C-3PO, K-3PO, TC-14, R-3PO, FX-9, David Ng (UBC, Canada)

This Summary for Policymakers should be cited as:

TIPCC AR1, 2014: Summary for Policymakers. Working Group to the First Assessment Report of the Tatooine Intergovernmental Panel on Climate Change, New Jedi University Press, Coruscant, Coruscant system, Core Worlds, Canada.

Pdf download: link (4.4Mb)

- – -

A. Introduction

The Working Group contribution to the TIPCC’s First Assessment Report (AR1) considers cumulative evidence of climate change based on many independent scientific analyses from observations of the climate system, paleoclimate archives, theoretical studies of climate processes and simulations using climate models. It represents a first concerted attempt to address the possible long term effects on the Tatooine geological and biodiversity systems, particularly as it pertains to the current unregulated practice of water mining.

This Summary for Policymakers (SPM) follows the structure of the Working Group report. The narrative is supported by a series of overarching highlighted conclusions which, taken together, provide a concise summary.

The degree of certainty in key findings in this assessment is based on the droid teams’ evaluations of underlying scientific understanding and is expressed as a qualitative level of confidence (from very low to very high) and, when possible, probabilistically with a quantified likelihood (from exceptionally unlikely to virtually certain). Confidence in the validity of a finding is based on the type, amount, quality, and consistency of evidence (e.g., data, mechanistic understanding, theory, models, expert judgment) and the degree of agreement.

Probabilistic estimates of quantified measures of uncertainty in a finding are based on statistical analysis of observations or model results, or both, and expert judgment. Where appropriate, findings are also formulated as statements of fact without using uncertainty qualifiers.

The basis for substantive paragraphs in this Summary for Policymakers can be found in the chapter sections of the underlying report and in the Technical Summary.

A.1 Treatment of Uncertainties in TIPCC AR1

The importance of consistent and transparent treatment of uncertainties is clearly recognized by the TIPCC in preparing its assessments of climate change. To promote consistency in the general treatment of uncertainty across this document as well as future ARs, droids have been asked to follow a brief set of guidance notes on determining and describing uncertainties in the context of an assessment.

The standard terms used to define levels of confidence in this report are as given in the TIPCC Uncertainty Guidance Note, namely:

Very high confidence (at least 9 out of 10 chance),
High confidence (about 8 out of 10 chance),
Medium confidence (about 5 out of 10 chance),
Low confidence (about 2 out of 10 chance), and
Very low confidence (about 1 out of 10 chance).

The standard terms used in this report to define likelihood of an outcome or result where this can be estimated probabilistically are:

Virtually certain (>99%),
Extremely likely (>95%),
Very likely (>90%),
Likely (>66%),
More likely than not (>50%),
About as likely as not (33 to 66%),
Unlikely (<33%),
Very unlikely (<10%)
Extremely unlikely (<5%),
Exceptionally unlikely (<1%)

B. Observed Changes in the Tatooine Climate System

Observations of the climate system are based on direct measurements and remote sensing from satellites and other platforms. Global-scale observations from the instrumental era began in the mid-19th century for temperature and other variables, with more comprehensive and diverse sets of observations available for the period 50BBY onwards. Paleoclimate reconstructions extend some records back hundreds to millions of years. Together, they provide a comprehensive view of the variability and long-term changes in the atmosphere and the land surface.

Warming of the climate system is unequivocal, and since the 50BBY, many of the observed changes are unprecedented over decades to millennia. The atmosphere has warmed, civilization released water vapour has increased significantly contributing to overall increase concentrations of greenhouse gases (see Figures SPM.1, SPM.2, and SPM.3)

B.1 Tatooine Atmosphere

Each of the last three decades has been successively warmer on Tatooine’s surface than any preceding decade since 100BBY (see Figure SPM.1 and SPM.2). In the Northern Hemisphere, 20BBY – 10ABY was likely the warmest 30-year period of the last 1400 years (medium confidence).

- For the longest period when calculation of regional trends is sufficiently complete (100BBY to 50BBY), almost the entire globe has experienced surface warming (see Figure SPM.1).

- The globally averaged combined land and ocean surface temperature data as calculated by a linear trend, show a warming of 0.85 [0.65 to 1.06] °C, over the period 120BBY to 10ABY, when multiple independently produced datasets exist. The total increase between the average of the 150BBY–100BBY period and the 0BBY–10ABY period is 0.78 [0.72 to 0.85] °C, based on the single longest dataset available (see Figure SPM.2).

- It is virtually certain that globally the troposphere has warmed since 50BBY. More complete observations allow greater confidence in estimates of tropospheric temperature changes in the extratropical Northern Hemisphere than elsewhere. There is medium confidence in the rate of warming and its vertical structure in the Northern Hemisphere extra-tropical troposphere and low confidence elsewhere.

- Changes in many extreme weather and climate events have been observed since about 50BBY. It is very likely that the number of cold days and nights has decreased and the number of warm days and nights has increased on the global scale. It is likely that the frequency of heat waves has increased in large parts of Northern Hemisphere. There are likely more land regions where the number of strong wind events has increased than where it has decreased. The frequency or intensity of strong winds has likely increased in 1000km radius around Mos Eisley. In other locations, confidence in changes in strong wind events is at most medium.

SPM.1
Figure SPM.1 (Click to Enlarge) Map of the observed surface temperature change from 100BBY to 10ABY derived from temperature trends determined by linear regression from one dataset (orange line in SPM.2). Trends were calculated where data availability permitted a robust estimate (i.e., all grid boxes had greater than 50% complete records and more than 20% data availability in the first and last 10% of the time period).

SPM.2
Figure SPM.2 (Click to Enlarge) Observed global mean combined atmospheric and land surface temperature anomalies, from 150BBY to 10ABY from three data sets. Top panel: annual mean values. Bottom panel: decadal mean values including the estimate of uncertainty for one dataset (black). Anomalies are relative to the mean of 75BBY – 25BBY.

B.2 Tatooine Water Cycle

The atmospheric concentrations of water, carbon dioxide, methane, and nitrous oxide have increased to levels unprecedented in at least the last 100,000 years. Water concentrations have increased by 40% since 50BBY, primarily from deregulation and corporatization of water mining practices.

- The atmospheric concentrations of the greenhouse gas water (H2O) has increased since 150BBY due to civilized activity. In 9ABY the concentrations of this greenhouse gas was 5112 ppm, and exceeded the pre-water mining deregulation levels by about 40%.

- Concentrations of H2O now substantially exceed the highest concentrations recorded in sand funnels during the past 500,000 years. The mean rates of increase in atmospheric concentrations over the past century are, with very high confidence, unprecedented in the last 22,000 years.

- Annual H2O escape emissions from water mining were 246 GtH2O yr–1 averaged over 0ABY – 10ABY (high confidence) and were 278 GtH2O yr–1 in 10ABY, 54% above the 30BBY level.

- From 50BBY to 10ABY, H2O escape emissions from water mining have released 12366 GtH2O to the atmosphere.

SPM.3
Figure SPM.3 (Click to Enlarge) Atmospheric concentrations of water (H2O) from Mos Eisley (dark blue), Douz outpost (medium blue), and Wayfar (light blue). Full details of the datasets shown here are provided in the underlying report and the Technical Summary Supplementary Material.

C. Drivers of Tatooine Climate Change

Natural and civilization based activity substances and processes that alter Tatooine’s energy budget are drivers of climate change. Radiative forcing (RF) quantifies the change in energy fluxes caused by changes in these drivers for 10ABY relative to 200BBY, unless otherwise indicated. Positive RF leads to surface warming, negative RF leads to surface cooling. RF is estimated based on in-situ and remote observations, properties of greenhouse gases and binary solar behaviour, and calculations using numerical models representing observed processes.

Total radiative forcing is positive, and has led to an uptake of energy by the climate system. The largest contributions to total radiative forcing is caused by the natural variations in solar energy and the water mining derived increase in the atmospheric concentration of H2O (see Figure SPM.4).

- The total civilization based RF for 10ABY relative to 200BBY is 8.57 W m−2 (see Figure SPM.4), and it has increased more rapidly since 50BBY than during prior decades. The total civilization based RF best estimate for 10ABY is 43% higher than that reported in 0BBY. This is caused by a combination of continued growth in H2O gas concentrations and improved estimates of downstream changes in other greenhouse gas concentrations.

- The RF from emissions of escaped water (H2O) for 10ABY relative to 200BBY is 5.98 [5.12 to 6.93] W m–2 (see Figure SPM.4).

- The total natural RF from solar irradiance changes is substantial and therefore, is carefully taken into account as a significant contribution to the net radiative forcing throughout the last century.

SPM.4
Figure SPM.4 (Click to Enlarge) Radiative forcing estimates in 10ABY relative to 200BBY and aggregated uncertainties for the main drivers of climate change. Values are global average radiative forcing (RF), partitioned according to the emitted compounds or processes that result in a combination of drivers. The best estimates of the net radiative forcing are shown as black circles with corresponding uncertainty intervals, the numerical values are provided on the right of the figure, together with the confidence level in the net forcing (VH – very high, H – high, M – medium, L – low, VL – very low).

D. Understanding the Tatooine Climate System

Understanding recent changes in the Tatooine climate system results from combining observations, studies of feedback processes, and model simulations. Evaluation of the ability of climate models to simulate recent changes requires consideration of the state of all modelled climate system components at the start of the simulation and the natural and civilization based forcing used to drive the models. Compared to previous studies, more detailed and longer observations and improved climate models now enable the attribution of a civilization based contribution to detected changes in more climate system components.

Civilization influence on the climate system is clear. This is evident from the increasing water concentrations in the atmosphere, positive radiative forcing, observed warming, and understanding of the climate system.

D.1 Evaluation of Tatooine Climate Models

Climate models have improved dramatically since previous studies. Models reproduce observed continental scale surface temperature patterns and trends over many decades, including the more rapid warming since 50BBY (very high confidence)

- The long-term climate model simulations show a trend in global-mean surface temperature from 50BBY to 10ABY that agrees with the observed trend (very high confidence). There are, however, differences between simulated and observed trends over periods as short as 10 to 15 years (e.g., 5BBY to 10ABY).

- On regional scales, the confidence in model capability to simulate surface temperature is less than for the larger scales. However, there is high confidence that regional-scale surface temperature is better simulated than at the time of previous studies.

- There has been substantial progress in the assessment of extreme weather and climate events since previous studies. Simulated global-mean trends in the frequency of extreme warm and cold days and nights over the second half of the 20th century are generally consistent with observations.

D.2 Quantification of Tatooine Climate System Responses

Observational and model studies of temperature change, climate feedbacks and changes in Tatooine’s energy budget together provide confidence in the magnitude of global warming in response to past and future forcing.

- The net feedback from the combined effect of changes in water vapour, and differences between atmospheric and surface warming is extremely likely positive and therefore amplifies changes in climate. Uncertainty in the sign and magnitude of possible cloud feedback is due primarily to continuing uncertainty in cloud formation processes.

- The equilibrium climate sensitivity quantifies the response of the climate system to constant radiative forcing on multi-century time scales. It is defined as the change in global mean surface temperature at equilibrium that is caused by a doubling of the atmospheric H2O concentration. Equilibrium climate sensitivity is likely in the range 1.5°C to 4.5°C (high confidence), extremely unlikely less than 1°C (high confidence), and very unlikely greater than 6°C (medium confidence). The lower temperature limit of the assessed likely range is thus less than 2°C, but the upper limit is the same. This assessment reflects improved understanding, the extended temperature record in the atmosphere and land surface, and new estimates of radiative forcing.

- The rate and magnitude of global climate change is determined by radiative forcing, climate feedbacks and the storage of energy by the climate system. Estimates of these quantities for recent decades are consistent with the assessed likely range of the equilibrium climate sensitivity to within assessed uncertainties, providing strong evidence for our understanding of civilization based climate change.

D.3 Detection and Attribution of Tatooine Climate Change

Water mining influence has been detected in the warming of the atmosphere and the land surface, in changes in the global water cycle, and in changes in some climate extremes. This evidence for civilization based influence has grown since 20BBY. It is extremely likely that influence from unregulated water mining has been the dominant cause of the observed warming since 50BBY

- It is extremely likely that more than three quarters of the observed increase in global average surface temperature from 50BBY to 10ABY was caused by the water mining increase in water gas concentrations and other civilization based forcings together. The best estimate of the water mining-induced contribution to warming is similar to the observed warming over this period.

- Escaped water gases contributed a global mean surface warming likely to be in the range of 0.5°C to 1.3°C over the period 50BBY to 10ABY, with the contributions from other anthropogenic forcings, including the cooling effect of aerosols, likely to be in the range of -0.6°C to 0.1°C. The contribution from natural forcings is likely to be in the range of -0.1°C to 0.1°C, and from natural internal variability is likely to be in the range of -0.1°C to 0.1°C. Together these assessed contributions are consistent with the observed warming of approximately 0.6°C to 0.7°C over this period, as calculated with consideration of solar irradiance cycles.

- It is very likely that water mining influence, particularly escaped water greenhouse gases has led to a detectable observed pattern of tropospheric warming since 60BBY.

E. Future Tatooine Climate Change and Effects

Projections of changes in the Tatooine climate system are made using a hierarchy of climate models ranging from simple climate models, to models of intermediate complexity, to comprehensive climate models, and Planetary System Models. These models simulate changes based on a set of scenarios of civilization based radiative forcings. These scenarios, the Representative Concentration Pathways (RCPs), was used for the new climate model simulations carried out under the framework of the Coupled Model Intercomparison Project Phase 2 (CMIP2) of the Core Worlds Climate Research Programme. In all RCPs, atmospheric H2O concentrations are higher in 100ABY relative to present day as a result of a further increase of cumulative emissions of H2O to the atmosphere during the next century. Projections in this Summary for Policymakers are for the end of 100ABY given relative to 20BBY to 10ABY, unless otherwise stated. To place such projections in historical context, it is necessary to consider observed changes between different periods. Based on the longest global surface temperature dataset available, the observed change between the average of the period 150BBY–100BBY and of the AR1 reference period is 0.61 [0.55 to 0.67] °C.

Continued unregulated/corporatized water mining and consequent emissions of escaped water will cause further warming and changes in all components of the climate system. Limiting climate change will require substantial and sustained reductions of water vapor emissions.

- Note that RCP5.98 represents a stoppage in water mining activities to allow for long term equilibrialization of atmospheric water amounts. RCP12.0 represents likely business as usual (BAU) models extrapolating water mining trends from 50BBY to present day. RCP8.5 and RCP7.0 represent various possible mitigation benchmarks under a BAU model.

E.1 Atmosphere: Temperature

Global surface temperature change for the end of the 100ABY century is likely to exceed 1.5°C relative to 150BBY to 100BBY for the RCP5.98 scenario. It is likely to exceed 4°C for RCP12.0. Warming will continue beyond 100ABY under all RCP scenarios except RCP5.98. Warming will continue to exhibit interannual-to-decadal variability and will not be regionally uniform.

- The global mean surface temperature change for the period 15ABY–30ABY relative to 10BBY-5ABY will likely be in the range of 0.3°C to 0.7°C (medium confidence). This assessment is based on multiple lines of evidence and assumes there will be no major volcanic eruptions or changes in predicted dynamic solar irradiance. Relative to natural internal variability, near-term increases in seasonal mean and annual mean temperatures are expected to be larger in the southern hemisphere than in the northern hemisphere (high confidence).

- Increase of global mean surface temperatures for 80ABY–100ABY relative to 10BBY–5ABY is projected to likely be in the ranges derived from the concentration-driven CMIP1 model simulations, that is, 0.3°C to 1.7°C (RCP5.98), 1.1°C to 2.6°C (RCP7.0), 1.4°C to 3.1°C (RCP8.5), 2.6°C to 4.8°C (RCP12.0).

- Relative to the average from year 1850 to 1900, global surface temperature change by the end of the 21st century is projected to likely exceed 1.5°C for RCP7.0, RCP8.5 and RCP12.0 (high confidence). Warming is likely to exceed 2°C for RCP8.5 and RCP12.0 (high confidence), more likely than not to exceed 2°C for RCP7.0 (high confidence), but unlikely to exceed 2°C for RCP5.98 (medium confidence). Warming is unlikely to exceed 4°C for RCP5.98, RCP7.0 and RCP8.5 (high confidence) and is likely to exceed 4°C for RCP12.0 (medium confidence).

SPM.5
Figure SPM.5 (Click to Enlarge) CMIP5 multi-model simulated time series from 60BBY to 110ABY for change in global annual mean surface temperature relative to 10BBY-5ABY. Time series of projections and a measure of uncertainty (shading) are shown for scenarios RCP5.98 (blue) and RCP12.0 (red). Black (grey shading) is the modelled historical evolution using historical reconstructed forcings. For further technical details see the Technical Summary Supplementary Material.

E.2 Effects on Tatooine Biodiversity

A large fraction of terrestrial species face increased extinction risk under projected climate change during and beyond 100ABY, especially as climate change interacts with other stressors, such as habitat modification, over exploitation, and pollution (high confidence).

- Extinction risk is increased under all RCP scenarios, with risk increasing with both magnitude and rate of climate change. Many species will be unable to track suitable climates under mid- and high-range rates of Tatooine climate change (i.e., RCP7.0, 8.5, and 12.0) during the next century (medium confidence). Lower rates of change (i.e., RCP5.98) will pose fewer problems. See Figure SPM.6. Some species will adapt to new climates. Those that cannot adapt sufficiently fast will decrease in abundance or go extinct in part or all of their ranges. Management actions, such as maintenance of genetic diversity, assisted species migration and dispersal, manipulation of disturbance regimes (e.g., wind storms), and reduction of other stressors, can reduce, but not eliminate, risks of impacts to terrestrial ecosystem due to climate change, as well as increase the inherent capacity of ecosystems and their species to adapt to a changing climate (high confidence).

- Within the next century, magnitudes and rates of climate change associated with medium- to high-emission scenarios (RCP7.0, 8.5, and 12.0) pose high risk of abrupt and irreversible regional-scale change in the composition, structure, and function of terrestrial ecosystems, including low sand areas (medium confidence).

SPM.6
Figure SPM.6 (Click to Enlarge) Maximum speeds at which species can move across landscapes (based on observations and models; vertical axis on left), compared with speeds at which temperatures are projected to move across landscapes (climate velocities for temperature; vertical axis on right). Civilization based interventions, such as transport or habitat fragmentation, can greatly increase or decrease speeds of movement. White boxes with black bars indicate ranges and medians of maximum movement speeds for various representative Tatooine biodiversity. For RCP5.98, 7.0, 8.5, and 12.0 for 20ABY–100ABY, horizontal lines show climate velocity for the global-land-area average and for large flat regions. Species with maximum speeds below each line are expected to be unable to track warming in the absence of intervention.

E.3 Tatooine Climate Stabilization, Climate Change Commitment and Irreversibility

Cumulative emissions of H2O largely determine global mean surface warming by 0BBY century and beyond. Most aspects of climate change will persist for many centuries even if water mining and subsequent emissions of H2O are stopped. This represents a substantial multi-century climate change commitment created by past, present and future emissions of H2O.

- Cumulative total emissions of H2O and global mean surface temperature response are approximately linearly related. Any given level of warming is associated with a range of cumulative H2O emissions, and therefore, e.g., higher emissions in earlier decades imply lower emissions later.

- Limiting the warming caused by water mining based H2O emissions alone with a probability of >33%, >50%, and >66% to less than 2°C since the period 150BBY – 100BBY, will require cumulative H2O emissions from all anthropogenic sources to stay between 0 and about 40133 GtH2O, 0 and about 33688 GtH2O, and 0 and about 27392 GtH2O since that period, respectively.

- A large fraction of civilization based climate change resulting from H2O emissions is irreversible on a multi-century to millennial time scale, except in the case of a large net removal of H2O from the atmosphere over a sustained period. Surface temperatures will remain approximately constant at elevated levels for many centuries after a complete cessation of net civilization based H2O emissions. Due to the long time scales of heat transfer from the land surface to deep sand, terrain warming will continue for centuries. Depending on the scenario, about 15 to 40% of emitted H2O will remain in the atmosphere longer than 1,000 years.

- Currently, model projections suggest a possibility (low confidence) of a irreversible global mean temperature rise that will continue beyond 100ABY. The few available model results that go beyond 100ABY indicate global mean temperature rise by 200ABY to temperatures reaching beyond all Tatooine biodiversity thresholds (medium confidence).

- – -

With apologies to:

IPCC, 2013: Summary for Policymakers. In: Climate Change 2013: The Physical Science Basis. Contribution of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change [Stocker, T.F., D. Qin, G.-K. Plattner, M. Tignor, S.K. Allen, J. Boschung, A. Nauels, Y. Xia, V. Bex and P.M. Midgley (eds.)]. Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA

IPCC, 2014: Summary for policymakers. In: Climate Change 2014: Impacts, Adaptation, and Vulnerability. Part A: Global and Sectoral Aspects. Contribution of Working Group II to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change [Field, C.B., V.R. Barros, D.J. Dokken, K.J. Mach, M.D. Mastrandrea, T.E. Bilir, M. Chatterjee, K.L. Ebi, Y.O. Estrada, R.C. Genova, B. Girma, E.S. Kissel, A.N. Levy, S. MacCracken, P.R. Mastrandrea, and L.L. White (eds.)]. Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, pp. 1-32.

- – -

More on Tatooine science via the below carnival!

About David Ng

David (@ng_dave) is Faculty at the Michael Smith Labs. His writing has appeared in places such as McSweeney's, The Walrus, and also as an occasional blogger at boingboing.net. If you're looking for a graphic for your next science talk, he encourages you to check out his blog, popperfont.net.

WOOKIEE FOREPLAY: TRANSGENERATIONAL EPIGENETIC REGULATION OF FORCE-SENSITIVITY BY ELABORATE DUET SONG

By | archive, creative, journal club

Just another reminder that this paper will be published in print format in the fall, along with selected SCQ pieces from the last 7 or so years. If you want to submit your creative science pieces with a mind to make the first issue of this new journal, then please visit here for more information.

APCMvol01p59front

Annals of Praetachoral Mechanics. (2014). Vol 1. pp59-69 pdf download

ABSTRACT

Wookiees (W. wookiee) are monogamous, sentient mammals that have traditionally produced long and elaborate duet songs. It has been repeatedly proposed that duet mating songs for Wookiees might function to improve the fitness of offspring. In this study we aimed to compare DNA methylation of genes that may influence force-sensitivity in Wookiee pups from singing and non singing parents. Here we report that prenatal exposure to duet song altered the offspring epigenome. We identified 390 differentially methylated genes by genome-wide methylation profiling technology. We found five force-sensitivity genes (UTFL, ASFYL, LSGB, and NTRP) that were differentially methylated in pups from duet singing parents and confirmed that altered methylation of ASFYL and HMOWK affects gene expression. Furthermore, pups from duet singing parents had more midi-chlorians per cell, indicating a greater awareness for the Force. Taken together, our findings demonstrate that Wookiee mating song behaviour during prenatal development has a positive benefit on offspring.

Keywords: Wookiee, song, force sensitivity, epigenetics, DNA methylation

Introduction

A number of animals in the galaxy are known to produce elaborate mating songs, most notably species of monogamous birds and a few arboreal mammals, mainly Ewoks (E. ewok) and Wookiees (W. wookiee). The functions most frequently proposed for duet songs include territorial advertisement and strengthening pair bonds (Geissmann, 1999; Haimoff, 1981). Prenatal exposure to duet songs is believed to improve the fitness of the developing offspring, but this has not yet been demonstrated in any species. Previous efforts in studying the effect of duet songs have been conducted in Ewok and been largely unsuccessful. This is mainly attributed to fact that Ewok are extremely uncooperative and mischievous subjects. Wookiee on the other hand, are much better subjects due to their renowned intelligence and a propensity for force-sensitivity that is closer to human than most creatures. In fact, there have been several adept Wookiees of the Force, notably Lowbacca. Despite their fearsome appearance, Wookiees have a natural gift for musical song and are surprisingly gentle and sensitive creatures if not provoked. The Wookiee mating call is an old tradition of the Kashyyyk, but sadly knowledge of the culture has been fading over many generations.

Previously, we speculated that the advent of a superior specimen with heightened force-sensitivity is largely determined by epigenetic transmission. Perhaps the most prominent example of this phenomenon is the birth of Luke and Leia from Queen Padmé Naberrie Amidala. Many scholars attribute the differences in their upbringing as to why Luke realized the Force much earlier in life than his twin sister. Hallmark findings in the past have established a direct relationship between the number of midi-chlorians per cell and sensitivity to the Force (Russell and Rocheleau, 2014). Recent findings suggest that epigenetic modifications established in the prenatal environment can have a life-long effect on midi-chlorian content.

Given that Wookiee couples that produce duet songs are believed to produce healthier offspring, we hypothesized that prenatal exposure to duet singing may also enhance force sensitivity. To compare the differences between pups from singing and non singing parents, we conducted a genome-wide methylation analysis to determine differentially methylated genes associated with force-sensitivity. Here we provide compelling evidence that Wookiee pups conceived from parents that produce duet mating songs have a great number of midi-chlorians, and hence are more sensitive to the Force, than pups from parents that have forgotten the ritual.

Materials and Methods

Wookiee pup sample collection.

Blood samples were collected from healthy Wookiee pups at the Rwookrrorro nursery ring by standard phlebotomy techniques after receiving written consent from their parents. Subjects were selected between the ages of 6-11 years and were identified as generally healthy and without a diagnosis or history of any force-deficiency disorders. After venipuncture, EDTA was added as an anticoagulant and samples were stored at −80 °C until use.

APCMv01p59table01

DNA extraction and hybridization to Illumina Infinium assay.

Genomic DNA was extracted and purified from whole blood using DNeasy blood and tissue kit (Qiagen, Valencia, CA) according to manufacturer’s protocol. DNA was quantified by NanoDrop 2000 Spectrophotometer (NanoDropTechnologies, Inc.) before transfer to 4°C for short-term storage or -20°C for long-term storage. A bisulphite conversion reaction was performed using 500 ng of genomic DNA according to manufacturer’s instructions for the Zymo EZ DNA Methylation kit (Zymo Research, Irvine, CA). The bisulfite-converted sample was then hybridized to the WookieeMethylation27 BeadChip (Illumina, San Diego, CA) and DNA methylation was evaluated at the Arkanis’ Obi-Wan Genome Sciences Centre (Tatooine, Outer Rim Territories).

Analysis of differentially methylated genes.

Results from the Illumina Infinium array were interpreted with GenomeStudio software. The WookieeMethylation27 BeadChip quantifies methylation levels at 27,578 CpG loci spanning 14,495 genes (Rev. by Gupta et al. 2010). The methylation status of CpG sites are calculated as the ratio of fluorescent signal from one allele relative to the sum of both methylated and unmethylated alleles. The resulting average β-intensity signals range from 0 (unmethylated) to 1 (fully methylated) to represent the percentage of methylation. Differential methylation was defined as a significant difference in percentage of methylation between pups from duet singing vs. non singing parents, where a difference in percentage of methylation was ≥33.3% or ≤-33.3%, combined with an ANOVA P value of <0.05. ANOVA P values were calculated using GraphPad Prism 6 software (GraphPad Software, Inc. La Jolla, CA). To test the potential influence of age, an additional statistical analysis was performed with a mixed model ANCOVA to consider age as a covariate (Partek). Array data have been submitted to the Sentient Genetics Omnibus repository (SGO) and are available under accession number SGO126584.

List of differentially methylated force-sensitivity genes.

A list of genes encoding proteins within the force sensitivity pathway was curated using the JEDI pathway database (episode 6.0). The resulting list was compared against results from the Illumina methylation array to identified genes with altered methylation in pups from duet singing and non singing parents.

Real-time PCR.

Total RNA was isolated from whole blood using the Tempus Spin RNA Isolation Kit according to manufacturer’s instructions (Applied Biosystems, Foster City, CA), followed by quantification by NanoDrop 2000 Spectrophotometer (NanoDropTechnologies, Inc.). First-strand cDNA synthesis was carried out using the TaqMan Reverse Transcription Reagents (Applied Biosystems) with random hexamers according to the manufacturer’s protocol. Triplicate samples for quantitative real-time PCR were run in the Applied Biosystems 7500 real-time PCR System using the Power SYBR Green PCR Mastermix (Applied Biosystems). Each reaction contained 1 μl of cDNA in a total volume of 20 μl. Results were normalized to β–actin transcript levels.

Quantification of midi-chlorian DNA copy number.

Midi-chlorians were enriched from whole blood samples using the Midi-chlorian extraction kit (SithTech, Tatooine, Outer Rim Territories) according to manufacturer’s protocol. McDNA was extracted by digestion with Proteinase K (100 μg/ml) in a buffer containing 50 mM KCl, 10 mM Tris-HCl, 2.5mM MgCl2 and 0.5% Tween-20. Samples were incubated overnight at 37˚C then boiled for 5 min. McDNA was linearized by digestion with ChewIII enzyme. McDNA content was measured by a multiplex real-time PCR method as previously described (Andreu et al. 2009). Primers to amplify a single copy mcDNA gene R2D2 and a mcDNA TaqMan probe were used (Applied Biosystems).

R2D2 forward primer: 5’-CAGAATGATATTTGTCCTTCA-3’
R2D2 reverse primer: 5’-GATATGAAAAACCATCGTTG-3’
R2D2 probe: 5’-TGCCAGCCACCGCG-3’

McDNA quantity was corrected by simultaneous measurement of a single copy nuclear gene C3P0 gene using a commercial (Applied Biosystems). Real-time PCR reactions consisted of 1 μL of pre-developed assay regent for C3P0 and 112 nM of each mcDNA primers and mcDNA probe, and 2–10 ng of total genomic DNA extract. Thermocycling was completed out on an Applied Biosystems 7500 real-time PCR System with the following conditions: 2 min at 50 °C and 10 min at 95 °C, followed by 40 cycles of 15 s of denaturation at 95 °C and 60 s of annealing/extension at 60 °C. Calibration curves were generated to quantify mcDNA and nuclear DNA copy numbers, which were based on the linear relationship between the crossing point cycle values and the logarithm of the starting copy number (Phillips, 2014).

Results

Prenatal exposure to Wookiee duet song impacts the DNA methylation profile of hundreds of genes.

Six pups from singing parents and six from non singing parents were recruited from the Rwookrrorro nursery for this study (Table 1). Based on personal communication and interviews with the parents, we were able to formulate a composition of a typical mating duet (Fig. 1A), as well as trace sonograms to describe the distinctive calls produced during a song (Fig. 1B). Overall, the duet mating song is an elaborate custom with a well-defined sequence of howls, barks and intermittent screams.

APCMv01p59fig1a
APCMv01p59fig1b
Figure 1 (Click to Enlarge). Duet mating song produced by adult Wookiee pairs. A: Schematic diagram illustrating the sequential nature of an entire mating duet. B: Sonagram tracings showing the types of call sequences produced during a song.

Using DNA isolated from whole blood samples, we used Illuminia Infinium technology to conduct genome-wide DNA methylation profiling. By a comparative statistical approach, we found that many genes are differentially methylated as a result of prenatal exposure to the duet song. We identified 390 genes showing differential methylation between pups from singing and non-singing parents (Fig. 2A). Of all the differentially methylated genes, 328 were hypomethylated and 62 were hypermethylated. In general, hypomethylation of gene promoters is associated with more robust transcriptional activity. Based on these findings, it appears that numerous genes are more active in pups from parents that sing duets.

APCMvol01fig02a
APCMvol01fig02b
Figure 2 (Click to Enlarge). DNA methylation levels in pups from duet singing and non-singing parents. The relative methylation of genes are displayed with heat maps for the 390 genes differentially methylated in pups from singing parents (A). 5 genes detected as differentially methylated in our array, are force-sensitivity genes (B).

Force-sensitivity genes are differentially methylated in pups from duet singing parents.

To focus on genes encoding proteins in the force-sensitivity pathway, we used the JEDI pathway database (episode 6.0) to generate a list of genes to be examined for differences in DNA methylation status. Comparing the list to our methylation array, we identified five genes that were differentially methylated in pups from parents that sing and do not sing (Fig. 2B). Of the differentially methylated force-sensitivity genes, four genes were hypomethylated (UTFL, ASFYL, LSGB, NTRP), and one was hypermethylated (HMOWK; Table. 2).

APCMv01p59table02

Methylation of ASFYL and HMOWK promoters affects gene expression.

An additional statistical analysis (ANCOVA) was performed for the selected force-sensitivity genes, where array-based methylation levels in singers were compared against non-singers while adjusting for age as a covariate. UTFL, ASFYL, and NTRP remained statistically significant (P < 0.05); however, the P values for LSGB and HMOWK became non significant and increased to 0.098 and 0.067 respectively. Nevertheless, the difference in methylation in HMOWK between singers and non-singers (Fig. 2B) is still biologically relevant. Among the differentially methylated force-sensitivity genes, two of them, mainly ASFYL and HMOWK are known to play a strong role in the control of force-sensitivity in humans. Previously, these genes have been implicated to be a determinant of longevity in Wookiees. ASFYL encodes a protein that regulates oxidative stress responses, and increased expression of ASFYL is associated with improved removal of reactive oxygen species (ROS) that are detrimental to cells. HMOWK encodes an ubiquitin ligase to the midi-chlorian outer membrane that has been proposed to play a role in the control of midi-chlorian morphology by regulating contacts with the endoplasmic reticulum and essential GTPases. This in turn promotes fusion of midi-chlorians as a mechanism to maintain midi-chlorian numbers in response to intrinsic signals.

We confirmed that DNA hypomethylation of ASFYL and hypermethylation of HMOWK affects gene expression by quantitative real-time PCR. As predicted, hypomethylation of ASFYL was associated with increased expression of ASFYL transcripts in pups from the singing parents group (Fig. 3A). Similarly, hypermethylation of HMOWK was associated with decreased HMOWK transcript levels in pups from the non singing group (Fig. 3B).

Fig3AB
Figure 3 (Click to Enlarge). RT-PCR validation of ASFYL and HMWOK expression. A: ASFYL, identified as hypomethylated in whole blood cells from pups, is expressed at significantly higher levels in those born to singing parents compared to non-singing. B: HMWOK, identified as hypermethylated in whole blood cells from pups, is expressed at significantly lower levels in those born to singing parents as compared with non-singing. Each result is normalized to a housekeeping gene (β-actin) to represent relative levels. Data are means ± SE (n = 6 subjects/group); *P < 0.05; **P < 0.005.

Wookiee duet song ritual enhances force-sensitivity in offspring.

A hallmark of Force aptitude is an elevated midi-chlorian level in cells. Hence, we quantified midi-chlorian DNA in blood samples from pups to determine whether prenatal exposure to duet songs can increase force-sensitivity. We used a multiplex pPCR assay as previously described (Phillips, 2014), and compared the midi-chlorian count per cell among the two groups, singing versus non singing parents. Statistical analysis (Wilcoxon signed-rank test) of mcDNA content revealed that pups born from singing parents had a significantly greater (P = 0.036) number of midi-chlorians per cell that those born to non-singing parents (Fig 4). To test the potential influence of age, an additional statistical analysis was performed with ANCOVA and we found that age was not a significant covariate.

APCMv01p59fig4
Figure 4 (Click to Enlarge). Force sensitivity is enhanced in pups from parents that produce the duet mating song. Force-sensitivity is represented by midi-chlorian count per cell and was determined by multiplex qPCR for the two groups (n = 6 subjects/group); *P <0.05.

Discussion

Previous attempts in identifying transgenerational effects mating behaviour produces on offspring have been inconclusive. In our study, we found outstanding differences in how genes are regulated epigenetically in pups from singing and non singing parents. The findings from our study can be summarized by four main points: DNA methylation profiles differ depending on whether or not the parents produce the Wookiee mating duet, several force-sensitivity genes are differentially methylated, hypo- and hypermethylation of critical force-sensitivity genes affect the level of gene expression, and pups from singing compared to non singing parents have a greater midi-chlorian content which may be attributed to DNA methylation. Here we provide direct evidence that mating behaviour can produce transgeneration effects on offspring by epigenetic mechanisms.

Our analysis identified five genes involved in the force-sensitivity pathway that are heavily influenced by DNA methylation, UTFL, ASFYL, LSB, NTRP, and HMOWK. This finding supports the notion of a direct link between prenatal care and force-sensitivity of offspring. In particular we found that ASFYL to be hypomethylated and HMOWK to be hypermethylated in pups from singing parents relative to those from non singing parents and that DNA methylation of these genes altered gene expression. Our data demonstrate that differential methylation in response to parental care can regulate gene expression across generations. Our findings also raise new questions such as whether maternal or parental behaviour produce the same effect on offspring, when during development are epigenetic modifications established, and if these changes can be reversed later in life.

It is accepted that midi-chlorians are ancient, symbiotic microbes that have established permanent residency inside the cells of every living form. When midi-chlorians are present in elevated numbers, they confer to the host the ability to detect the Force. A typical human has an average of 2,400 midi-chlorians per cell, while a Wookiee may have anywhere from 1,600-1,800. Our results show that prenatal exposure to Wookiee duet songs can increase the midi-chlorians content, to a level that is comparable to humans. Given that the duet singing custom is rapidly declining in Wookiees, efforts should be made to preserve the culture and to educate Wookiees of its positive benefits to offspring.

Literature Cited

Andreu, A. L., Martinez, R., Marti, R., & García-Arumi, E. (2009). Quantification of mitochondrial DNA copy number: Pre-analytical factors. Mitochondrion , 242-246.

Carvalho, R. H., Haberle, V., Hou, J., van Gent, T., Thongjuea, S., van IJcken, W., et al. (2012). Genome-wide DNA methylation profiling of non-small cell lung carcinomas. Epigenetics & Chromatin , 1-18.

Geissmann, T. (1999). Duet songs of the Siamang, Hylobates syndactylus: II. Testing the pair-bonding hypothesis during a partner exchange. Behaviour , 1005-1039.

Gupta, R., Nagarajan, A., & Wajapeyee, N. (2010). Advances in genome-wide DNA methylation analysis. BioTechniques , 49 (4), iii-xi.

Haimoff, E. H. (1981). Video Analysis of Siamang (Hylobates syndactylus) songs. Behaviour , 128-151.

Khor, G. H., Froemming, G. R., Zain, R. B., Abraham, M. T., Tan, S. K., Tan, A. C., et al. (2013). DNA Methylation Profiling Revealed Promoter Hypermethylation-induced Silencing of p16, DDAH2 and DUSPI in Primary Oral Squamous Cell Carcinoma. Int J Med Sci , 1727-1739.

Organa, L., Blue, D., & Naberrie, P. (2002). Sentient Genetics Omnibus: STAR gene expression and hybridization array data repository. Nucleic Acids Res , 207-210.

Phillips, N. R., Sprouse, M. L., & Roby, R. K. (2014). Simultaneous quantification of mitochondrial DNA copy number and deletion ratio: A multiplex real-time PCR assay. Scientific Reports , 1-7.

Rager, J. E., Bauer, R. N., Müller, L. L., Smeester, L., Carson, J. L., Brighton, L. E., et al. (2013). DNA methylation in nasal epithelial cells from smokers: identification of ULBP3-related effects. Am J Physiol Lung Cell Mol Physiol , L432-L438.

Russell, G., & Rocheleau, G. (2014). Genetic basis for force-sensitivity in Wookies. Annals of Praetachoral Mechanics , 1, 22-28.

Skywalker, A., Fett, J., Marek, G., Offee, B., & Brood, M. (2046). JEDI: Intergalactical Encyclopedia of Genes and Genomes. Nucleic Acids Res , 27-30.

Weaver, I. C., Cervoni, N., Champagne, F. A., D’Alessio, A. C., Sharma, S., Seckl, J. R., et al. (2004). Epigenetic programming by maternal behavior. Nature Neuroscience , 7 (8), 847-854.

About Abhinav Ajay Kumar and Jacky Kieran Leung

Abhinav Ajay Kumar is a UBC Pathology and Laboratory Medicine student working on the relationship between HIV infection, antiretroviral therapy and cellular aging. He loves to spends his weekends playing soccer and cricket. #ManchesterUnited #onceunitedalwaysunited. Jacky Leung is a UBC pathology graduate student at the BC Cancer Agency working on a cure for prostate cancer. He enjoys quiet times with his ill-mannered cat, Betty, and wishes to one day own a food truck.

METATRANSCRIPTOME OF GUT MICROBIOTA IN WOOKIEES WITH SEVERE INFLAMMATORY BOWEL DISEASE REVEALS DISTINCT PATHOGENIC COMMUNITY COMPOSITION AND FUNCTIONAL PROFILE

By | creative, journal club

Just another reminder that this paper will be published in print format in the fall, along with selected SCQ pieces from the last 7 or so years. If you want to submit your creative science pieces with a mind to make the first issue of this new journal, then please visit here for more information.

APCMvol01p49FRONT

Annals of Praetachoral Mechanics. (2014). Vol 1. pp49-58 pdf download

ABSTRACT

As the Galactic Empire continues to invade Kashyyyk, surviving Wookiees are finding refuge with humans on Alderaan. However, displaced Wookiees are exhibiting severe inflammatory bowel disease (IBD) -like symptoms. We hypothesized that dysbiosis in the microbiota of the gut exists between IBD-afflicted refugee Wookiees compared to healthy Wookiees that remain on Kashyyyk. To test this, we conducted a metatranscriptomic survey of the fecal microbiome in the two Wookiee populations. Our results show decreased microbial diversity in IBD fecal samples. Also, IBD patients showed a significantly increased population of Proteobacteria and reduced population of Lachnospiraceae and Firmicutes. We also found that Fusobacteriaceae and Clostridiaceae were unique to the microbiome in IBD patients. Functional analysis of the microbiome revealed significant enrichment in secondary metabolite biosynthesis and defense mechanism pathways. Additionally, considerably more transcripts were assigned with an unknown function in IBD samples. Taken together, we propose that the changes in community structure and function observed in IBD patients are indicative of a severely dysfunctional gut microbiome. Considering the drastic change in environment from Kashyyyk to Alderaan, including food variety, it is possible that this is a causal factor in IBD-afflicted Wookiees. Further investigation is needed to reveal the underlying mechanism of this microbiome discrepancy and possible treatment.

Key words: Transcriptomics, inflammatory bowel disease, Wookiee, microbial community structure, microbial community function

Introduction

The ongoing invasion by the Galactic Empire on the jungle planet Kashyyyk, native home to the humanoid species Wookiees, has led to a diaspora of Wookiees seeking refuge on planet Alderaan. Currently, the Alderaanian planetary government has provided a home to over 2000 Wookiees, mainly females and children who have survived battle. However, many of the refugee Wookiees have developed a severe gastrointestinal disorder. The symptoms of this disorder are very similar to inflammatory bowel disease (IBD) in humans. Common symptoms in Wookiees include severe abdominal pain, diarrhea, excessive hair loss, bloody vomit and stool, loss of vision, severe weight loss, and eventually death. Considering the severity of this illness, the Royal Alderaanian Institute of Genomics is collaborating with Wookiee researchers at the Kashyyyk Health Congress in Rwookrrorro, who remain in hiding on planet Kashyyyk. This study represents a collaborative effort to determine a causal factor for this illness and provide research direction for treatment

In humans, IBD is an acute or chronic condition characterized by gross intestinal inflammation which affects more than 3.6 million humans on Alderaan [1, 4]. The two main forms of IBD are Crohn’s disease and ulcerative colitis [2]. IBD has been associated with environmental, genetic and dietary factors and there is increasing evidence that the microbial community in the gut has a direct relationship with inflammation in the GI tract [2, 3, 4].

The human gut is home to 1014 microorganisms [8]. Microbial diversity exists between individuals in a population depending on genotype, age, health status and diet [5]. Human research has shown that these bacteria are beneficial for nutrient metabolism, immune function and repressing the growth of harmful microorganisms [4, 5]. In humans, studies show that IBD is associated with decreased gut microbial diversity, a decreased population in bacteria phylum Firmicutes and increased Proteobacteria populations [4, 9]. To elucidate the underlying cause of this IBD-like disorder in Wookiees, we suggest that a difference exists between the population of gut microbiota between IBD-affected Alderaan-residing Wookiees (henceforth IBD-afflicted) and healthy control Kashyyyk-residing Wookiees. We also suspect that there will be dysbiosis of the gut community between these two groups. To test for this, we will be sampling the gut microbiota by taking fecal samples from affected Alderaan-dwelling Wookiees and their unaffected counterparts living in Kashyyyk. In order to gain insight into the gut microbial diversity, we extracted total RNA and pyrosequenced transcripts to evaluate the active microbial community, and we purified and sequenced prokaryotic mRNA to map the functional abilities of the gut microbiome in both IBD and healthy Wookiees. To our knowledge, this is the first study comparing the microbiome in two Wookiee populations.

Methods

Sample collection

This study is a collaborative project between the Royal Alderaanian Institute of Genomics and the Kashyyyk Health Congress. Alderaan and Kashyyyk teams were responsible for identifying 10 Wookiee individuals for study on each planet. After informed consent was provided, fecal samples were collected from 10 IBD afflicted individuals at the Juranno General Hospital Intensive Care Unit on Alderaan and 10 healthy volunteers from the last remaining Wookiee stronghold in Rwookrrorro on Kashyyyk. Healthy individuals were screened for intestinal disorders or recent antibiotic treatment. Sterile containers with 30 mL of saline buffer were used for collection and samples were stored at -80°C until required. Previous human studies have determined that microbiota along the intestinal tract are correlated with the microbiota of fecal matter, eliminating the need for invasive ileum sampling [5].

Total RNA extraction and mRNA purification

Total RNA was extracted from 1 g of frozen sample using the RiboPure-Bacteria kit (Ambion) following the manufacturer’s instructions. Each sample was separated into rRNA for phylogenetic analysis and into mRNA for functional analysis. Full methods for separation are found in Turnbaugh et al. 2010 [6]. Briefly, mRNA was amplified using the MessageAmp II-Bacteria kit (Ambion), where bacterial mRNAs were adenylated with E.coli poly(A) polymerase and linearly amplified. Both total RNA and purified mRNA were converted to cDNA with SuperScript II reverse transcriptase (Invitrogen).

Pyrosequencing

cDNAs (5 ug cDNA samples) were sequenced at Princess Leia Life Sciences Centre (Aldera) on a Roche GS FLX sequencer. Sample transport from Kashyyyk was arranged via delivery on the Millennium Falcon light freighter through a generous donation of time and expertise by H. Solo Enterprises.

Community profiling

Profiling of sequence data was performed to identify 16SrRNA tags (taxonomy) and mRNA tags (function), as described in Urich et al. 2008 [7]. Taxonomic tags were compared with 5000 pre-selected rRNA sequences from the Kashyyykian Centre for Biotechnology Information (KCBI) environmental metagenome database. Species identification were made using BLAST with a 100 bp fragment and a 97% sequence homology cut off. Large Subunit rRNA and 23S rRNA were not included in the analysis. Taxonomic relationships were inferred from 16S rRNA sequences using the recently developed Kashyyykian Prokaryotic Tree of Life tool (KProTol) [8]. Taxonomy was provided for the genus level where possible. All unassigned rRNA tags were labelled as such. The Shannon Index of Biodiversity was also computed for IBD and healthy fecal samples.

Functional profiling

cDNA sequences reverse transcribed from the enriched mRNA pool were aligned to the KCBI protein database and phylogenetically binned using MEGAN. As in Urich et al. 2008 [7], the MG-RAST (Meta Genome Rapid Annotation using Subsystem Technology) and the SEED database were used to predict unclassified protein hits into broad metabolic pathways (e.g. nitrogen metabolism, carbohydrate metabolism etc). Transcripts binned into each metabolic pathway group were compared between healthy and diseased fecal samples such that the relative abundance of each pathway could be compared between samples.

Results

Sequencing

Pyrosequencing of the 10 healthy fecal samples produced an average of 701,457 reads between 75 and 700 bp in size at an average read length of 264 bp. Pyrosequencing of the 10 IBD afflicted fecal samples produced an average 754,132 reads between 80 and 732 bp and an average read length of 254 bp. Of the cDNAs sequenced, 18.9% and 17.9% corresponded to 16S cDNA representing the active bacteria in the healthy and IBD datasets, respectively, All cDNAs that did not result in a hit in the KCBI rRNA database (132,575 and 134,989 reads from healthy and IBD samples, respectively) were compared to the KCBI protein database where about 48% of these reads found known homologues.

Taxonomic assignment of 16S cDNA

The KProTol tool produced a microbial community structure for pooled healthy vs. IBD fecal samples (Figure 1). The two largest phyla represented in each dataset of healthy and IBD-afflicted Wookiees were Firmicutes and Bacteriodetes. In healthy individuals, this corresponded to 49% and 31%, respectively, of the 16S rRNA transcripts. Also, Proteobacteria made up the next largest represented phylum (4.9%), with Actinobacteria in relatively small abundance (0.6%) and unassigned reads corresponding to 14.5% of the healthy individuals dataset. At the phyla level, the IBD dataset showed a significantly reduced (p<0.05) Firmicutes abundance (41%), while the abundance of the Bacteroidetes was comparable (29%) to the healthy dataset. The Proteobacteria were significantly (p<0.05) enriched in the IBD dataset, due almost entirely to a 60-fold increase in the Proterobacteria family Enterobacteriaceae. At the family level, Lachnospiraceae (Firmicutes) were also significantly reduced (p<0.05) in the IBD samples (Fig 1). Two families, Fusobacteriaceae and Clostridiaceae were unique to the IBD dataset (Fig 1). The relative abundance of the Firmicutes family, Ruminococcaceae (7.9-10.1%), were similar among both datasets (Fig 1). Within the Bacteriodetes, the families Bacteroidaceae (8.1-9.8%), Prevotellaceae (4.2-6.4%) and Rickenellaceae (2.8-3.2%) had similar relative abundance in both IBD and healthy individuals (Fig 1). Microbial diversity, as measured by the Shannon index, was significantly lower (p<0.05) in the IBD samples (H=1.1) vs. healthy samples (H=2.3).

APCMvol01p49fig01

Figure 1 (Click to Enlarge): Composition of active microbiota in healthy and IBD Wookiee fecal samples

Functional assignment of mRNAs

Known and MG-RAST-predicted functional assignment of mRNAs in healthy and IBD afflicted Wookiees are shown in Figure 2. In general, functional pathways did not differ significantly between both data sets in most cases. Overall, energy production and conservation, carbohydrate transport and metabolism, and lipid transport and metabolism, were well represented in the datasets. However, significant (p<0.05) overrepresentation of secondary metabolite biosynthesis and defense mechanism pathways were found in IBD afflicted patients, with secondary metabolite biosynthesis and defense mechanisms being 4 and 5 times higher, respectively, in IBD vs. healthy samples. Additionally, IBD samples contained 2.5 times more transcripts of unknown function relative to healthy individuals.

APCMv01p49fig02

Figure 2 (Click t Enlarge): Functional analysis of mRNA tags from healthy and IBD Wookiee fecal samples samples assigned to functional categories. Asterisks represent significant differences (p<0.05)

Discussion

Current research in humans has revealed that gut microbial communities require a delicate balance to maintain health of the host [5, 9, 10, 11]. In IBD patients the host-microbe intestinal homeostasis may be in ‘dysbiosis,’ and in the case of IBD-afflicted Wookiee refugees on Alderaan, this dysbiosis may be proving fatal.

Our results point to several examples of dysbiosis in the gut of IBD-afflicted Wookiees. The decreased microbial diversity found in IBD fecal samples corresponds with studies done in humans [4, 12]. Additionally, the predominant phyla in both datasets are the Firmicutes and Bacteroidetes, similar to human gut microbiota [13], though IBD afflicted Wookiees showed a significantly reduced population of Firmicutes (Fig 1). Within the Bacteroidetes phylum, the relative abundance Bacteroidaceae, Prevotellaceae and Rickenellaceae were similar between datasets, with pectin/cellulose degradation function often ascribed to these families [10], suggesting these families may not be related to IBD pathogenesis. Decreased relative abundance of Lachnospiraceae, as seen in Wookiee IBD-afflicted fecal samples, has been reported in previous human studies [14], and may indicate that for IBD-afflicted Wookiees, this bacterial family has beneficial effects for host gastrointestinal health, but further study is required.

Complex interactions between the host immune system, host genotype and bacteria in the GI tract are believed to be responsible for the pathogenesis of IBD, although the underlying mechanisms remain unclear [11]. In this study, we present data showing three families either appearing in higher numbers in Wookiee IBD fecal samples or that are unique to the Wookiee fecal samples. Specifically, our analysis shows that Enterobacteriaceae appear to be enriched in IBD-afflicted Wookiees, while Fusobacteriacae and Clostridiaceae are unique to the Wookiee fecal samples (Fig 1). Enterobacteriaceae are gram-negative anaerobes that, through in vitro studies, have shown the ability to invade epithelial cells and induce granulomas [4]. Fusobacterium are also gram-negative anaerobes and are normally found in the oral cavity and occasionally the gut. Experimental models show that Fusobacterium varium can induce colonic mucosal erosion rectal enema [4]. The invasive nature of these bacteria may be a causal factor in IBD [4]. Segmented Filamentous Bacteria (Clostridiaceae, SFB) are an obscure and uncultivated bacterial species [5]. Mouse models show that SFB is involved in inducing colitis and significantly induce IgA response in humanoids [5]. Colonization of these bacteria in the GI tract is temporally related to the development of immune system in hosts [5]. These three pathogenic bacterial families present in IBD fecal samples may suggest involvement in the severe IBD-related symptoms.

The functional profile presented in Figure 2 demonstrates that for most of the functional groups identified, there were no major differences between IBD and healthy Wookiees. Most of the functional groups that were sequenced corresponded to energy production and conservation, carbohydrate transport and metabolism, and lipid transport and metabolism, suggesting that the functional role of the gut microbiota is largely based on energy production and nutrient processing, as has been found elsewhere [10]. The observed increase in secondary metabolite biosynthesis in IBD fecal samples provides evidence that the microbial community in IBD patients is over producing secondary metabolites, which can exhibit host toxicity if the metabolite is both toxic and produced in high volumes [16]. Additional sequencing is required to identify possible gene products from secondary metabolite biosynthesis that may play a role in Wookiee IBD pathogenesis. Defence mechanism metabolism was also highly elevated in IBD samples (Figure 2), which may be a microbial defense response to a host immunoresponse to IBD-related pathogenesis. Transcripts with no known function were also highly enriched in IBD fecal samples vs. healthy samples. This is the first result of its kind to be reported for IBD, although in this case there is an unusual severity in IBD-afflicted Wookiees transplanted to Alderaan. We can only speculate that these transcripts may be involved in the severity of the IBD in the Wookiees. Increased efforts to identify the gene products from these transcripts are currently underway.

It has been well documented that diet can directly affect the microbial community in the GI tract of humans [4]. Considering the drastic change from their planet Kashyyyk in diet and in the general environment, it is likely that IBD in Wookiees has been a result of these contributing factors. The IBD symptoms in Wookiees are therefore likely a result of a combination of the reduction in microbial diversity, increased Enterobactiaceae, Fusobacteriaceae and Clostridiaceae and a decreased Lachnospiraceae. This dysbiosis is supported by the relative increase of mRNA transcripts affiliated with secondary metabolite biosynthesis, defense mechanism pathways and a hitherto unknown functional pathway. The unknown functional pathways require further investigation as the underlying severe pathogenesis of the Wookiees may be directly related to this unique result. Human clinical trials have indicated that various probiotic treatments of live microbial supplements shows efficacy in IBD patients [5][6]. Since the intestinal bacteria are thought to comprise an important environmental factor in the pathogenesis of IBD, a more thorough understanding of the host-microbe intestinal dysbiosis is needed for elucidating the underlying mechanisms of IBD and for the treatment or prevention of this disease.

Conclusion

Overall, we suggest that the discrepancy between microbial populations may be causing the inflammatory bowel disease-like symptoms in Wookiees currently inhabiting Alderaan. The change in food variety and diet on Alderaan may be the culprit for afflicted individuals, although further investigation is required to confirm this. Future studies should investigate treatment options that have proven successful in human trials, such as probiotic supplements [5]. Future studies should determine the causal mechanism and transcripts involved in the pathogenesis of IBD in Wookiees.

Literature Cited

1. Şengül, N., Işık, S., Aslım, B., Uçar, G., & Demirbağ, A. E. (2011). The effect of exopolysaccharide-producing probiotic strains on gut oxidative damage in experimental colitis. Digestive diseases and sciences, 56(3), 707-714.

2.Baumgart, D. C., & Carding, S. R. (2007). Inflammatory bowel disease: cause and immunobiology. The Lancet, 369(9573), 1627-1640.

3. Centers for Disease Control and Prevention CDC. Inflammatory Bowel Disease. Division of Public Health. Accessed at www.cdc.gov/ibd/‎, 2014.

4. Kostic, A. D., Xavier, R. J., & Gevers, D. (2014). The Microbiome in Inflammatory Bowel Diseases: Current Status and the Future Ahead.Gastroenterology.

5. Peterson, D. A., Frank, D. N., Pace, N. R., & Gordon, J. I. (2008). Metagenomic approaches for defining the pathogenesis of inflammatory bowel diseases. Cell host & microbe, 3(6), 417-427.

6. Turnbaugh, P. J., Quince, C., Faith, J. J., McHardy, A. C., Yatsunenko, T., Niazi, F., … & Gordon, J. I. (2010). Organismal, genetic, and transcriptional variation in the deeply sequenced gut microbiomes of identical twins.Proceedings of the National Academy of Sciences, 107(16), 7503-7508.

7. Urich, T., Lanzén, A., Qi, J., Huson, D. H., Schleper, C., & Schuster, S. C. (2008). Simultaneous assessment of soil microbial community structure and function through analysis of the meta-transcriptome. PLoS One, 3(6), e2527.

8. Seymour, S, Anderson, D, et al. (2013) The Integrative Future of Taxonomy. Academic Press. 59(8), 25-28.

9.Berry, D., & Reinisch, W. (2013). Intestinal microbiota: A source of novel biomarkers in inflammatory bowel diseases?. Best Practice & Research Clinical Gastroenterology, 27(1), 47-58.

10. Gosalbes, M. J., Durbán, A., Pignatelli, M., Abellan, J. J., Jiménez-Hernández, N., Pérez-Cobas, A. E., … & Moya, A. (2011). Metatranscriptomic approach to analyze the functional human gut microbiota. PloS one, 6(3), e17447.

11.Reiff, C., & Kelly, D. (2010). Inflammatory bowel disease, gut bacteria and probiotic therapy. International Journal of Medical Microbiology, 300(1), 25-33.

12. Gevers, D., Kugathasan, S., Denson, L. A., Vázquez-Baeza, Y., Van Treuren, W., Ren, B., … & Xavier, R. J. (2014). The Treatment-Naive Microbiome in New-Onset Crohn’s Disease. Cell host & microbe, 15(3), 382-392.

13. Mahowald, M. A., Rey, F. E., Seedorf, H., Turnbaugh, P. J., Fulton, R. S., Wollam, A., … & Gordon, J. I. (2009). Characterizing a model human gut microbiota composed of members of its two dominant bacterial phyla. Proceedings of the National Academy of Sciences, 106(14), 5859-5864.

14.Frank, D. N., Amand, A. L. S., Feldman, R. A., Boedeker, E. C., Harpaz, N., & Pace, N. R. (2007). Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proceedings of the National Academy of Sciences, 104(34), 13780-13785.

15. Medema, M. H., Blin, K., Cimermancic, P., de Jager, V., Zakrzewski, P., Fischbach, M. A., … & Breitling, R. (2011). antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences. Nucleic acids research, 39(suppl 2), W339-W346.

16. Chewbacca, R.H. 2010. Toxicity of secondary metabolites in humanoids. Annals of Praetachoral Mechanics 2(1), 48-61.

(Please note that this paper is not real)

About Tim Philpott, Rayeheh Bahar and Jess Morrice

Tim Philpott is a PhD student in the Faculty of Forestry's Belowground Ecosystem Group at UBC, where he is applying metatranscriptomics to soil ecology (and hopefully before a new sequencing technology makes his new skills obsolete). Rayeheh Bandar is a MSc student in Experimental Medicine Program at UBC working on an epidemiological study on the prevalence of different skin diseases in various ethnicities, with a focus on Hyperhidrosis disease (an excessive sweating condition). Jess Morrice a MSc student in the department of Pathology at UBC, studying the pathogenesis of Amyotrophic Lateral Sclerosis (ALS) and specifically the interactions between microglia and neurons during early stages of the disease.

HOW TO MAKE A HAIRLESS WOOKIEE: IDENTIFICATION AND FUNCTION OF DE NOVO GLABR GENE IN WOOKIEE WOOKIEE

By | archive, journal club

(This is the THIRD paper on a special issue on Wookiee science. You can read the first here, and the second here).

APCMV01p29pageone

Annals of Praetachoral Mechanics. (2014). Vol 1. pp29-38 pdf download.

ABSTRACT

We present evidence for the de novo origin of the Wookiee wookiee protein-coding gene GLABR since their divergence from humans. This gene has no protein-coding homolog in any other genome but its presence is supported by evidence from expression and hybridization data. Furthermore, other near-human species such as Zeltron, Chiss, and Sullustan share the human ortholog of this locus, which supports the inference that the ancestral sequence was noncoding, and that the GLABR has de novo origins in the Wookiee. This GLABR gene was further characterized by a conditional knockout experiment as well as an in situ hybridization on sectioned epithelial cells in order to better determine its function. Our results show that the GLABR gene is responsible for robust hair growth in Wookiees, and that inactivation of this gene results in reduced androgenic hair growth or hairless phenotype.

Keywords: GLABR, hair gene, hair loss, Wookiee wookiee

INTRODUCTION

New Order Laboratories is a subsidiary of the former X1’s Fortress. Originally established as a cloning laboratory, it has since expanded to include an active research and development program. At New Order Laboratories, we aim to expand on the original Wookiee wookiee cloning program, and produce innovative wookiee research to aid the Dark side in their endeavor to rule the galaxy.

Wookiees are favorable to the Dark side due to their destructive bouts of sheer rage, and physical strength. As a whole, wookiees possess several other traits conducive to warfare beginning with the fact that they are a tree dwelling species, an attribute denoted by their species name Wookiee, which translates to “People of the Trees.” As tree-dwellers, Wookiees evolved to have skillful hands and claws. Wookiees also possess fangs and a highly advanced sense of smell.

A distinguishing feature of Wookiee wookiee is their “shag carpet” appearance: a trait that in conjunction with their exceptional height makes this native Kashyyyk species immediately recognizable. Notably, visibility is an attribute not conducive to the Dark side’s desired covert operations. W. wookiee as a subspecies are identifiable by their fur, which can be uniform in color or a composite of the colors red, brown, and/or chestnut.

At New Order Laboratories, we aim to identify the biological mechanism responsible for W. wookiee hairiness. In conjunction with the Cloning Division, we hope to eventually create hairless, humanoid Wookiee clones for the Dark side.

To begin, we hypothesize that distinct morphological features, in other words, hairiness are a result of Wookiee specific protein-coding gene(s). As Wookiees are a humanoid species, we postulate that when an all-against-all comparison is done with the Wookiee wookiee and Homo Sapien genomes, a portion of the Wookie genome will be distinct. As a consequence, we suggest that elements of these distinct regions will likely be responsible for the hairiness or uniform coat of hair that is so distinct.

MATERIALS AND METHODS

Systematic analysis of the Wookiee genome
A complete BLASTP search of all human, and Wookiee proteins from Ensembl (Hubbard et al. 2007) v 46 with an E-value threshold of 1 x 10-4 was performed according to the protocol set forth in Knowles and McLysaght (2009). Un-ambiguous orthologs were identified and synteny blocks anchored to these regions. A region of 10 genes or less was deemed an acceptable gap between anchors, and thus variability in the gene order was allowed. Anticipated orthologous ORFs in the regions above were defined as BLAT (Kent 2002) or SSearch (Pearson and Lipman 1988) sequence matches.

Ensembl noted several orthologs in more distantly related humanoid species. Further examination of the annotated orthologs was completed to determine if these were old genes that became inactivated in wookiees. Potential orthologs that contained multiple implausible small introns were discarded. For example, the current Ensembl version proposes a Chiss ortholog of BLU31 (gene responsible for their characteristic blue skin), but further investigation concluded that the “gene” lacks possible introns and thus cannot produce any resemblance of a protein in wookiee. Otherwise, the absence of the phenotypic characteristics of plausible orthologs was attributed to the theorized inactivation within the genomes of other humanoid species.

Initial de novo gene candidates were as follows: 100 had a sequence in the expected human region; 65 had conceivable orthologs in the expected human region; 20 candidates exhibited partial nucleotide similarity; 9 Wookiee genes were deemed artifacts; and one candidate had a possible ortholog in Ewok. A final list of candidates consisted of 5 genes: 4 had uninterrupted ORF in Wookiee of at least 50% of the length of the human ORF.

Multi- PipMaker (Schwartz et al. 2000) was used to align the sequence of the wookiee gene to the syntenic location in the human genome. JalView (Clamp et al. 2004) was employed to visualize the sequences and make manual adjustments when applicable.

Wookiee subjects
Wookiee wookiee (New Order standard) samples were obtained from the Wookiee wookiee clonal collection on planet Mustafar. Specimens used in quantitative RT-PCR experiments were kept under controlled conditions for 3-5 days.

Knockout wookiees
Conditional knockout wookiees were generated via gene targeting in wild-type standard W. wookiee by TaconicArtemis. In situ hybridizations were done on [carbonite]-sectioned material with a dioxygenic-based labelling system. Northern blots were done with 10µg total RNA via denaturing agarose gel electrophoresis.

Microarray analysis
Microarray analysis was done on the Wookiee Genome 430 2.0 array, and probe data from the Imperial standard CEL files were normalized via the MAS5 method with the R-based bioconductor software. The normalized probe set data was searched for differentially expressed genes with the significance analysis of microarrays.

RESULTS AND DISCUSSION

Identification of W. wookiee genes with no protein-coding match in protein database or syntenic human genomic region
Principal sites of synteny were established between the human and W. wookiee genome using unambiguous orthologs or shared regions pinpointed by the BLASTP search hits. Synteny blocks established spanned 82% and 74% of the human and Wookiee genomes, respectively, and 18,505 of the 22,568 human protein-coding genes characterized in Ensembl were identified within the established range.

A region of 10 genes was established as an acceptable gap between blocks due to the expected high gene order conservation between the two species. An additional screen for plausible orthologs was conducted in these regions as probability higher for the noted locations in the genome.

An initial 200 candidate Wookiee proteins were identified (no BLASTP hit in the human genome). For 65 proteins, a plausible ortholog existed but upon further examination with BLAT and SSearch only partial nucleotide similarity was identified, leaving 20 candidates. Wookiee genes with conceivable orthologs in other species were also excluded i.e. ewok ortholog.

For the purposes of this screen, only characterized or known W. wookiee genes by Ensembl were considered. Above protocol resulted in one Wookiee protein-coding gene (GLABR) that did not appear to have an ortholog in any other species; genome, however there did appear to be sequence similarity at the expected location of the gene in humans. It is therefore possible that the GLABR gene is of de novo origin. (GLABR was assigned to the Wookiee protein coding for hairlessness as “glaber,” a Latin word meaning hairless or bald).

In order to confirm the de novo origin of the GLABR ortholog, we performed a multiple sequence alignment of the GLABR sequence with the orthologous human sequence (Figure 1). The critical mutation that allows the production of a protein is the deletion of an A nucleotide in the GLABR ortholog, which is present in the human ortholog. This causes a frameshift in Wookiee that results in a much longer ORF capable of producing a 137-amino-acids-long protein; in contrast, the human sequence has a stop codon after only 78 potential codons.

fig01APCMv01p29

Figure 1. (Click to Enlarge) Sequence changes in the origin of W. wookiee GLABR from noncoding DNA: multiple sequence alignment of the gene sequence of the W. wookiee gene GLABR and similar nucleotide sequences from the syntenic location in humans. The start codon is indicated on the figure.

The identified W. wookiee transcript GLABR spans a 453kb region that can be aligned with the human genome, but the human homeolog is free of annotated transcripts or expressed sequence tags (ESTs). We prepared a northern blot with RNA from wookiees and from humans to substantiate the findings that the human aligned region is not expressed (Figure 2); a signal was obtained from the standard W. wookiee subspecies as well as the wild-type W. wookiee species, but not from the human, and other closely related near-human species. This indicates that the non-coding ortholog of the gene is the ancestral sequence, and the gene that confers hairiness to W. wookiees must have originated after the speciation event, approximately 4.7 million years ago. Thus, the gene must have arisen de novo in W. wookiee.

Fig02APCMv01p29

Figure 2. (Click to Enlarge) Northern blot with RNA from Wookiees, human, and related humanoid species. 1kb mRNA fragment containing the putative GLABR sequence is observed only in Wookiee samples, denoting non-expression in other humanoid type gene expression profiles. Note in this figure, the old New Order nomenclature for W. wookiee (W. rwook) is used.

GLABR protein function
We designed a conditional knockout of the whole gene region to study the function of this GLABR and confirm our hypothesis. We find that the wookiees that lack the GLABR transcript “W. wookiee glaber” are viable and fertile, and the general physiology is not changed, aside from the reduction in androgenic hair growth (Figure 3).

fig03APCMv01p29

Figure 3: (Click to Enlarge) Artist’s representation of a wild-type wookiee (left) and the GABR variant (right). The latter exhibits a marked reduction in androgenic hair, but the vellous hair is still present.

Skin samples were taken from wild-type and GLABR strain wookiees and in situ hybridizations were performed on carbonite-sectioned epithelial material with a dioxygenic-based labeling system (Figure 4). The wild-type section exhibits higher androgen localization towards the androgenic hair roots, whereas the GLABR variant section exhibits much less. These results complement the previous observation that androgenic hair growth was markedly reduced in the GLABR variant (Figure 3). Although for the purpose of this study, it was only necessary to confirm that there was reduced hair growth in the GLABR variants, it would be worth investigating the exact mechanism by which this reduction occurs. Such studies would also examine possible side effects exhibited in the knockout variant.

fig04APCMv01p29

Figure 4: In situ hybridizations on carbonite-sectioned epithelial specimens from wild-type and GLABR variants, with a dioxygenic-based labeling system.

CONCLUSIONS

This is the first study to focus on uncovering the gene or mechanism behind Wookiee wookiee’s characteristic coat of hair. It is also serves as the first comparative human to W. wookiee genome research. Prior to this research, there are few reports of research into wookiees, and none assessing what genome similarity with humans (if any) could be responsible for their humanoid appearance.

The GLABR protein described in this study functions exclusively to code for W. wookiee’s hairiness. As noted in our results, the hairless wookiee phenotype does not appear to exhibit additional morphological or physiological changes, although we did observe some anecdotal evidence of behavioural modifications. In our knockout W. wookiee glaber (or “Chewie2.0” as we called him), we noted a more docile demeanor when conducting routine laboratory assessments. We hypothesize that the resulting hair loss correlates to a hormonal difference in the normal wookiee androgen levels. This possibility is concerning as it may preclude undesirable physical changes, such as (but not limited to) reductions in muscle mass or physical strength. At present, a research program is being developed to resolve whether this phenomenon is present in all subsequent knockouts.

Further study is also warranted to assess W. wookiee glaber skin sensitivity. While not usually an apparent issue in the species, it is conceivable that rendering them hairless may manifest problematic symptoms. Here, we noted several rash-like symptoms when subjects were clothed, although it remains unclear whether this was a reaction to the garment’s material, or due to other environmental factors such as room temperature or light. W. wookiee culture does not generally encourage individuals to be clothed, but one could argue that such items are deemed culturally unnecessary due to their thick coat of hair. Nevertheless, as seen in mammals, it is likely that W. wookiee hair provides protection from the environment. It is therefore important to weigh the positive and negative impacts of generating a hairless knockout in the context of these various points.

The gene reported in this study is the first case of a W. wookiee protein-coding gene that appears to be restricted to the W. wookiee genome. It is well-documented by this research that the GLABR protein-coding gene is not present in the human genome or any other humanoid species. It is therefore likely that the gene appeared in the W. wookiee genome after the divergence from the human lineage. To conclude, we would hypothesize that Wookiee-specific genes are responsible for Wookiee specific traits i.e. GLABR is responsible for hairiness in Wookiees. It will be interesting going forward to explore whether non-specific genes in Wookiees code for similar characteristics between humanoid species.

Acknowledgments
The authors would like to thank the dark side of the Force, and Conan Motti for donating his life to Science (source of Homo sapien tissue).

Conflict of interest
Dark side.

Funding
The authors gratefully acknowledge the funding support from the New Order and the Dark Lords of the Sith for a studentship awarded to E.M. J.S. was supported through a NOR research scholarship from the Galactic Research Council.

LITERATURE CITED

Clamp M, Cuff J, Searle SM, Barton GJ. (2004) The Jalview Java alignment editor. Bioinformatics 20:426–427.

Heinen, TJ, Staubach F, Haming D, Tautz D (2009) Emergence of a new gene from an intergenic region. Current Biology 19:1527-31.

Hubbard TJ, Aken BL, Beal K, Ballester B, Caccamo M, Chen Y, Clarke L, Coates G, Cunningham F, Cutts T, et al. (2007) Ensembl 2007. Nucleic Acids Res 35:D610–D617.

Kent WJ. (2002) BLAT—the BLAST-like alignment tool. Genome Res 12:656–664.

Knowles, DG, McLysaght A. (2009) Recent de novo origin of human protein-coding genes.
Genome Res 19:1752-9.

Pearson WR, Lipman DJ. (1988) Improved tools for biological sequence comparison. Proc Natl Acad Sci 85:2444–2448.

Schwartz S, Zhang Z, Frazer KA, Smit A, Riemer C, Bouck J, Gibbs R, Hardison R, Miller W. (2000) PipMaker—a web server for aligning two genomic DNA sequences. Genome Res 10:577–586.

About Emily Murphy and Jenny Shin

Jenny Shin studies Biology at the University of British Columbia. She is delighted that this paper has been a source of enlightenment for the Dark Side. Emily Murphy is a 1st-year MSc student in the Department of Wood Science. When not weeping over her willow in the lab, she enjoys listening to peppy East Coast jigs and long drives through the countryside.

GENETIC BASIS FOR FORCE-SENSITIVITY IN WOOKIEES

By | journal club

(This is the second paper on a special issue on Wookiee science. You can read the first here).

JPCMV1pp21front

Annals of Praetachoral Mechanics. (2014). Vol 1. pp21-28 pdf download.

ABSTRACT
Midi-chlorians are sentient life forms, which live in endosymbiosis with all living cells (1). The number of midi-chlorians per cell has been found to correlate with influence in the force (2) and, as such, blood analysis has become common practice for the identification of force-sensitives, particularly by the Jedi Order. However, the genetic basis for increased midi-chlorian replication in force-sensitives is unknown. Here we show drivers to be mutations at both positions 263 and 312012 in Wookiee wookiee midi-chlorian DNA (mdDNA). We anticipate our findings to be a starting point for in vivo studies linking these mutations to force-sensitive phenotypes.

Key words: Force-sensitivity, midi-chlorian, single nucleotide variants

INTRODUCTION

The need for a powerful army has grown more pertinent in the wake of the rebellion against the Empire. Much research has been aimed at creating powerful fighters for the Sith (3). Sand People, Twi’lek, and Mon Calamari have all been considered, but Wookiees (Wookiee wookiee) are of particular interest due to their intelligence, large size, incredible strength, and unwavering loyalty (4). While powerful in their own right, Wookiees armed with the ability to harness the force have the potential be unstoppable soldiers. As the ability to harness the force has been correlated with midi-chlorian count in red blood cells (5), methods for increasing midi-chlorian count in Wookiee cells are of profound interest. However, and for as yet unknown reasons, all experiments that have aimed to increase expression of Wookiee specific midi-chlorians within Wookiee species have proved unsuccessful. More recently, evidence has demonstrated that force sensitive humans not only have higher numbers of midi-chlorians, but that several specific single nucleotide polymorphisms within the midi-chlorian genome may be responsible for hyper proliferation. Consequently, there have already been attempts to directly transplant force-sensitive-human midi-chlorians into Wookiee oocytes. However, these attempts have also failed, indicating Wookiee mdDNA and human mdDNA differ by genes essential for Wookiee cell proliferation (6). As a result, more advanced genetic techniques, and elucidation of midi-chlorian genome structure, are required to increase midi-chlorian count in Wookiees.

Here, we report sequence for both Human and Wookiee midi-chlorian genomes, and identify candidate mutations linked to Dark-side force-sensitivity. We then show characterization of synthesized artificial Wookiee mdDNA containing these candidate mutations. In particular, we determine effects on host-midi-chlorian replication by qPCR.

METHODS

Collection and Preparation of Blood Samples
mdDNA was isolated from blood samples as previously described (14). Briefly, blood cells were lysed by incubation with SDS and Protenase K, and then whole-cell lysates were subject to CsCl–bisbenzimide gradient centrifugation. CsCl–bisbenzimide gradients allow for separation of nuclear DNA from mdDNA based on A + T content (mdDNA is A+T rich). DNA quality was assessed by spectrophotometry (260 nm/280 nm and 260 nm/230 nm absorption ratios) and gel electrophoresis prior to library construction.

Midi-chlorian DNA Extraction
1ng input mdDNA was prepared using Nextera XT DNA Sample Preparation Kit (Illumina). Samples were barcoded with a 13bp unique index on each end to allow for analysis of 96 samples per flowcell, while maintaining coverage of >10000x per midi-chlorian genome. Libraries were sequenced with 2×150 bp reads on the Illumina JediSeq 2000 system.

Midi-chlorian Protein Extraction
Enriched midi-chlorians were lysed by adding 1ml Qiagen Native Lysis Buffer, and incubating on ice for 30 minutes with periodic gentle agitation.

Synthesis and Isolation of Midi-chlorian Genome
The Gibson et al. assembly method (9) was used to generate a synthetic midi-chlorian genome. It was important to minimize genome manipulation during the detergent and proteolytic enzyme treatments by suspending the cells in agarose blocks. Intact chromosomes were immobilized in the resulting cavern in the agarose that originally held the cell. Digested protein components, lipids, RNAs, and sheared genomic DNAs could then be removed by dialysis or electrophoresis from the immobilized intact genomic DNA. Whole, intact genomic DNA isolation was performed using a CHEF Mammalian Genomic DNA Plug Kit from Bio-Rad (7).

Isolation of midi-chlorians
Human and Wookiee blood samples were centrifuged at 600xg for 15 minutes to pellet cells. Cell pellets were resuspended in PBS to a final concentration of 1×108 cells/ml. Cell suspensions were lysed by forced movement through a 27G syringe needle, in the presence of a protease inhibitor cocktail (Roche, Germany). Crude cell lysate was incubated with 30ul anti-MATR microbeads for 60 minutes at 4°C. Treated lysate was loaded onto preequilibrated MACs column (Milyenyi Biotec). The column was placed in a MACS Separator (Miltenyi Biotec) and then midi-chlorians were washed and eluted according to Hornid-Do et al.’s method (8). Midi-chlorians were then pelleted and resuspended in MdIB (Midichlorian Incubation Buffer, Sigma-Aldrich).

Removal of original midi-chlorian genome
The native midi-chlorian genome was extracted under an inverted microscope (Nikon; model TMD). Cored Glass Tubes (Narishige; GD-1: I. D., 0.75 mm x O. D. 1 mm x length, 90 mm) and a Pressure Microinjector (Narishige; model IM-5B) were used with the added control of a Joystick Hydraulic Micromanipulator ((Narishige; system MO-204) to apply gentle suction and remove the native genome.

Insertion of synthesized midi-chlorian genome
CHEW5 cell line obtained from Dr. Darklord at Imperial University. CHEW5 in a 6-ml culture of SOB medium containing 17% fetal bovine serum and 0.5% glucose. Incubation was at 37°C until the medium pH was 6.2. Cells (5 to 50 × 107 cells/ml) were then spun in a centrifuge at 4575g for 15 min at 10°C. Cells were washed once [Tris 10 mM and NaCl 250 mM (pH 6.5)], resuspended with 200 ml of CaCl2 (0.1 M), and held on ice for 30 min. Synthetic midi-chlorian genome agarose plug was then added.

Real-time PCR
Primers and probes were designed using Primer 3, and checked for possible hairpin and self-dimer formation using IDT Oligo Analyzer 3.1. swBLAST was used to ensure specificity to the target of interest. Assays were validated, both in singleplex and multiplex, using dilution series of purified Wookiee mdDNA and purified Wookiee nuclear DNA (supplemental).

GAPDH Forward Primer: TCTCTGCTTCTGATGGCTCAAAC
GAPDH Reverse Primer: TGCTCTTCCGATCTGACAGCGACC
GAPDH Probe: 5’-FAM-TATTCGAGTAGC-MGBNFQ-3’
WOMDC Forward Primer: GGCTACCTATGAGGTCACTTTA
WOMDC Reverse Primer: TTCAGGTAGTAACACTGGGTA
WOMDC Probe: 5’-VIC-GGCTATCAACGT-MGBNFQ-3’

Real-time PCR was performed using the TaqMan® Fast Universal PCR Master Mix from Applied Biosystems (10ul of TaqMan® Fast Universal PCR Master Mix (2✕), No AmpErase® UNG, 0.5ul of 10uM GAPDH Probe, 0.8ul of 10uM GAPDH Forward Primer, 0.8ul of 10uM GAPDH Reverse Primer, 0.5ul of10uM WOMDC Probe, 0.8ul of 10uM WOMDC Forward Primer, 0.8ul of 10uM WOMDC Reverse Primer, 4.8ul of H2O, and 1ul of lysed culture). Thermocycling was carried out on a BioRad DNA Engine with Chromo4 Real-time PCR Detector (hot-start at 95 °C for 20 s, and 50 cycles of 1 s at 95 °C and 20 s at 60 °C).

RESULTS AND DISCUSSION

Single Nucleotide Variant Determination
Whole blood samples were obtained from 96 non-force-sensitive (NFS) Humans, 10 Sith, and 86 Wookiees. Specimens were collected as part of a research project approved by the Empire Force Agency Research Ethics Board (EFA REB). We sequenced the mdDNA isolated from each sample. NFS Human, and Wookiee midi-chlorian genomes were de-novo assembled using ABySS (12) with N50 sizes ranging from 34624 to 50348. Single nucleotide polymorphisms (SNPs) within the NFS Human subset were identified using SAMtools (supplementary Figure 1).

Sith mdDNA reads were aligned to the NFS Human draft genome using Burrows-Wheeler Aligner version 0.5.4 (13). Screening for SNPs by SAMtools followed by subtraction of known SNPs from the NSF human data set yielded four single nucleotide variants (SNVs) at positions: 257 (A/G), 35768 (T/G), 274491 (G/T), and 289002 (T/G).

We then used Projector, a pair hidden Markov model-based program, to identify homologues to the Sith midi-chlorian genes containing SNVs in the Wookiee midi-chlorian genome (11). Candidate SNVs positions in the Wookiee midi-chlorian genome were then identified by visual inspection of gene homologs: 263 (A/G), 35769 (G/T), 266724 (A/G), and 312012 (C/T).

Midi-chlorian Synthetic Genome Synthesis
Using Gibson et al.’s technique for chemical genomic synthesis (7), we created 15 synthetic Wookiee midi-chlorian genomes containing mutations at the positions of the candidate SNVs identified (Table 1). Synthetic genomes were prepared for storage and transformation using CHEF Mammalian Genomic DNA Plug Kit from Bio-Rad, as in Gibson et al. (2009) (7).

APCMV1p21table01

CHEW5 Mutant Creation
Midi-chlorians were extracted from human and Wookiee blood, using Hornig-Do et al.’s magnetic field method, along with MACs Column and Separator from Miltenyi Biotec (8). Whole midichlorian extract was 99% pure, as determined through blotting of crude cell lysate and enriched midi-chlorians using probes for β-actin (cytoskeleton), GAPDH (cytosol), Rab4 (Golgi apparatus), Golgin-97 (endosome), and HanSo (midi-chlorian).

The native Midi-chlorian genome was removed under an inverted microscope using a microsyringe, leaving the wookie midi-chlorian intact. Midi-chlorian synthetic genomes were transferred into genome-free Wookie Midi-chlorians using the Lartigue et al. method (7), involving treatment of midi-chlorians with CaCl2 and then heat shock in the presence of synthetic genome agarose plugs. To ensure only midi-chlorians containing a single genome were carried through to subsequent steps, suspensions were incubated with a FISH probe specific to a repetitive region of the Wookiee midi-chlorian genome (6) and then FACS was used to sort midi-chlorians: negligible fluorescence intensity indicating that the midi-chlorian did not successfully take up the DNA, one arbitrary fluorescence unit indicating that the midi-chlorian took up one copy of the mdDNA, and two arbitrary fluorescence units indicating that the midichlorian took up two copies of the mdDNA etc. (Supplementary Methods). One midi-chlorian per cell was microinjected into CHEW5 cells, and presence was verified by optical microscopy.

Determination of Midi-chlorian Production by qPCR
Single CHEW5 cells containing midi-chlorians with synthetic genomes (SG), and control CHEW5 cells, were placed into wells of a 96-well plate and were cultured as described previously (6). Five replicates of each were seeded. At 6, 12, 24, 48, 72, and 96 hours after seeding, 2ul of each culture was extracted, lysed (Cell-md Direct Kit, Darth Distributors), and used as template in a two-colour qPCR assay. An assay specific to the constant region of Wookiee mdDNA (WOMDC) was used to assess quantity of midi-chlorians (VIC channel). To account for differences in cell proliferation among cultures, an assay for GAPDH, a housekeeping gene on Wookiee nuclear DNA, was used (FAM channel). The difference in cycle threshold values (ΔCT) between WOMDC and GAPDH assays was used to compare midi-chlorian replication (Figure 1).

APCMV1p21figure01
Figure 1. (Click to Enlarge): Difference in cycle threshold values (ΔCT) between WOMDC and GAPDH assays over 96 hours.

CHEW5-SG13 and CHEW5-SG15 mutants were not viable. Of the remaining 13 CHEW5 mutants, 10 did not significantly differ from normal CHEW5 in their midi-chlorian replication behaviour (p= 0.67, t test). Both CHEW5-SG6 cells and CHEW5-SG8 cells demonstrated high per-cell midichlorian counts, but CHEW5-SG6 mutants appeared unstable, as demonstrated by a consistently decreasing ΔCT over the six time points.

Growth curves for CHEW5-SG8 and CHEW5 cells were obtained by OD600 (Supplementary Figure 4). The presence of the midi-chlorian containing SG8 in the CHEW5 cells does not appear to affect CHEW5 proliferation.

Midi-chlorians were extracted (see Methods) from each CHEW5-SG8 culture, lysed, and the total proteomes were analyzed on a 2 dimensional gel (Figure 2). The boxes highlight a single protein difference between the CHEW5 and CHEW5-SG8 proteomes. As expected this protein corresponds to one found in Sith midi-chlorian.

APCMV1pp21figure02
Figure 2 (Click to Enlarge). Midi-chlorian proteomic analysis. Two-dimensional gels were run using midi-chlorian lysates from (A) Sith cells (B) CHEW5 cells, and (C) CHEW5-SG8 cells. Standard conditions were used for the separation of protein spots in the first dimension on immobilized pH gradient (IPG) strips (pH range 4 to 7) and in the second, SDS-PAGE, dimension (molecular mass 8 to 200 kD) (10). Gels were stained with Coomassie brilliant blue G-250.

CONCLUSIONS

Four SNVs linked to dark-side force sensitivity were determined through sequence alignment of NFS Human and Sith mdDNA. Wookiee genomes containing mutations homologous to the identified human SNVs were synthesized and then inserted into midi-chlorians. Midi-chlorians containing each synthetic genome were inserted into CHEW5 cells. Because of the existing, well-documented link between force-sensitivity and increased midi-chlorian count (2) , qPCR assays were used to identify CHEW5 mutants producing high levels of midi-chlorians. The CHEW5-SG8 mutant, containing mutations at positions 263, and 312012, was found to steadily produce high levels of midi-chlorians. Analysis of the proteome of CHEW5-SG8 midi-chlorians revealed one protein also found in Sith midi-chlorians. To definitively determine that midi-chlorian SG8 imparts force-sensitivity to its host, in vivo experiments are required. Our group has begun preparations for a trial involving transplantation of midi-chlorians containing SG8 into Wookiee oocytes, and in vitro fertilization of these oocytes in to female Wookiees.

LITERATURE CITED

1. Baaka C (2012) in The Wookieepedia Volume 312: Midichondrians as Sentient Life, eds. Ng D, Smith M (Springer, Heidelberg), pp 403–420.

2. Baaka C (2012) in The Wookieepedia Volume 312: Midichondrian Count in Relation to Force Sensitivity, eds. Ng D, Smith M (Springer, Heidelberg), pp 1106–1158.

3. Plageuous D, Nemisis A (2424) The Clone Wars diaries: Attempt to create evil life. Proc Natl Acad Sci EARTH 966:10802-10831.

4. Skywalker L (1999) Physical and social characteristics of Wookiees: a field study. Gal Anal Biol 88:302-333.

5. Calrisian L (2008) in the jedi handbook on midi-chlorian count, ed Kanobe OBO (Springer, Heidelberg) 2:30-40.

6. Sotired I, Falcon M, Iwannagotosleep PLS (2011) Wookiee mdDNA and human mdDNA differ by genes essential for Wookiee cell proliferation, Science 172: 3076-3083.

7. Lartigue C, Glass JI, Alperovich N, Pieper R, Parmar PP, Hutchison III CA, Smith HO, Venter JC (2007) Genome transplantation in bacteria: changing one species to another, Science 317(632); 632-638.

8. Hornig-Do HT, Günther G, Bust M, Lehnartz P, Bosio A, Wiesner RJ (2009) Isolation of functional pure mitochondria by superparamagnetic microbeads, Anal Biochem 389(1): 1-5.

9. Gibson DG, et al. (2010) Creation of a bacterial cell controlled by a chemically synthesized genome. Science 329(52);52-56.

10. Outofideas IAM, (2013) in Intergalactic species midi-chondrial proteome project: humanoids, ed Dorky I, (Silly University Press) pp 300078-487699

11. Meyer IM, Durbin R (2004) Gene structure conservation aids similarity based gene prediction. Nucleic Acid Res. 32(2); 776-783.

12. Simpson JT (2009) ABySS: A parallel assembler for short read sequence data. Genome Res. 19(6): 1117–1123.

13. Li H, Durbin R (2010) Fast and accurate long-read alignment with Burrows-Wheeler Transform. Bioinformatics 26(5):589-95

14. Lang F, and Burger G (2007) Purification of mitochondrial and plastid DNA. Nature Protocols 2(3): 652-660.

About Georgia Russell and Genevieve Rocheleau

Georgia is a Master's student in the Genome Science and Technology program at the University of British Columbia. Her project involves using microfluidic devices to learn more about the immune system's response to cancer. Genevieve is opposed to cuddling and is a 5th year Cell Biology and Genetics student at UBC Vancouver. Although she shys away from various forms of physical comfort, she does make time to work in Dr. Ninan Abraham's lab at the Life Sciences Institute; to volunteer as a Director of Events for UBC REC; and to cook relatively inedible meals.